Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0629626076:

Variant ID: vg0629626076 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 29626076
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.51, T: 0.49, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:

TTATTATTATTATTATTATTATTATTATTATTATTATTGAATGATAAAATATGAATAGTACTTTATGTACGACTTATTTTTTTAAATTTTTTAAATAAAA[T/C]
AGACAATCAAATGTTAAGCATAGTAATCTATAACTGAATTTAAAATAAAACGGGGAGTACGTATTATTGGGGAGAGAGATAGAGAGAGACAGGGGGAGTG

Reverse complement sequence

CACTCCCCCTGTCTCTCTCTATCTCTCTCCCCAATAATACGTACTCCCCGTTTTATTTTAAATTCAGTTATAGATTACTATGCTTAACATTTGATTGTCT[A/G]
TTTTATTTAAAAAATTTAAAAAAATAAGTCGTACATAAAGTACTATTCATATTTTATCATTCAATAATAATAATAATAATAATAATAATAATAATAATAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	33.20%	30.10%	7.45%	29.26%	NA
All Indica	2759	40.60%	5.50%	11.34%	42.59%	NA
All Japonica	1512	14.60%	81.30%	0.99%	3.11%	NA
Aus	269	42.40%	3.70%	4.46%	49.44%	NA
Indica I	595	39.50%	17.00%	13.61%	29.92%	NA
Indica II	465	33.10%	1.50%	14.41%	50.97%	NA
Indica III	913	45.70%	0.50%	5.59%	48.19%	NA
Indica Intermediate	786	39.90%	4.80%	14.50%	40.71%	NA
Temperate Japonica	767	2.20%	95.70%	0.39%	1.69%	NA
Tropical Japonica	504	25.20%	68.10%	2.38%	4.37%	NA
Japonica Intermediate	241	31.50%	63.50%	0.00%	4.98%	NA
VI/Aromatic	96	90.60%	3.10%	1.04%	5.21%	NA
Intermediate	90	32.20%	30.00%	12.22%	25.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0629626076	T -> C	LOC_Os06g48930.1	upstream_gene_variant ; 3603.0bp to feature; MODIFIER	silent_mutation	Average:89.948; most accessible tissue: Zhenshan97 young leaf, score: 94.037	N	N	N	N
vg0629626076	T -> C	LOC_Os06g48940.1	upstream_gene_variant ; 140.0bp to feature; MODIFIER	silent_mutation	Average:89.948; most accessible tissue: Zhenshan97 young leaf, score: 94.037	N	N	N	N
vg0629626076	T -> C	LOC_Os06g48930-LOC_Os06g48940	intergenic_region ; MODIFIER	silent_mutation	Average:89.948; most accessible tissue: Zhenshan97 young leaf, score: 94.037	N	N	N	N
vg0629626076	T -> DEL	N	N	silent_mutation	Average:89.948; most accessible tissue: Zhenshan97 young leaf, score: 94.037	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0629626076	T	C	-0.03	-0.03	-0.03	-0.01	0.0	0.0

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0629626076	NA	3.92E-15	mr1276	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629626076	NA	8.14E-39	mr1480	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629626076	NA	2.76E-07	mr1659	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629626076	NA	5.75E-50	mr1692	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629626076	NA	1.73E-18	mr1968	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629626076	NA	4.99E-06	mr1153_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629626076	NA	1.29E-18	mr1168_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629626076	NA	2.96E-10	mr1232_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629626076	NA	6.96E-07	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629626076	NA	1.98E-17	mr1557_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629626076	NA	3.94E-11	mr1714_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629626076	NA	4.70E-10	mr1806_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629626076	NA	5.05E-23	mr1968_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251