\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0629530652:

Variant ID: vg0629530652 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 29530652
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


GTTATTGTTTTTGGTGTTACTGACATGTAGGCCCACAATTTTTAGGCCGAGTCAAATTAGCCATGTAGGCATCACGTCAGCGCAAACCGCCGTCCAAAAC[G/A]
CCTTGGGCTTCACCGGTTTTGACAGTTGAGAGACATGTTGTTTTTCGGTGGAAGGACGAAAATCGGATTCGTTGACAAGTTAAGGGACCTAAAATGAACT

Reverse complement sequence

AGTTCATTTTAGGTCCCTTAACTTGTCAACGAATCCGATTTTCGTCCTTCCACCGAAAAACAACATGTCTCTCAACTGTCAAAACCGGTGAAGCCCAAGG[C/T]
GTTTTGGACGGCGGTTTGCGCTGACGTGATGCCTACATGGCTAATTTGACTCGGCCTAAAAATTGTGGGCCTACATGTCAGTAACACCAAAAACAATAAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.30% 8.20% 0.51% 0.00% NA
All Indica  2759 99.30% 0.50% 0.14% 0.00% NA
All Japonica  1512 75.60% 23.20% 1.19% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.70% 0.00% 0.34% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 98.20% 1.50% 0.25% 0.00% NA
Temperate Japonica  767 96.30% 2.10% 1.56% 0.00% NA
Tropical Japonica  504 37.10% 61.90% 0.99% 0.00% NA
Japonica Intermediate  241 90.00% 9.50% 0.41% 0.00% NA
VI/Aromatic  96 90.60% 8.30% 1.04% 0.00% NA
Intermediate  90 84.40% 14.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0629530652 G -> A LOC_Os06g48780.1 upstream_gene_variant ; 1699.0bp to feature; MODIFIER silent_mutation Average:63.632; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg0629530652 G -> A LOC_Os06g48800.1 downstream_gene_variant ; 4153.0bp to feature; MODIFIER silent_mutation Average:63.632; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg0629530652 G -> A LOC_Os06g48790.1 intron_variant ; MODIFIER silent_mutation Average:63.632; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0629530652 NA 2.91E-14 mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629530652 NA 1.03E-11 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629530652 3.63E-07 NA mr1422 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629530652 NA 5.24E-09 mr1422 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629530652 NA 1.50E-08 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629530652 NA 4.57E-07 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629530652 NA 6.27E-07 mr1696 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629530652 NA 5.84E-08 mr1304_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629530652 NA 2.91E-07 mr1347_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629530652 NA 1.14E-09 mr1398_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629530652 NA 2.62E-06 mr1398_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629530652 NA 9.55E-15 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629530652 NA 4.47E-08 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629530652 NA 7.16E-06 mr1583_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629530652 NA 5.79E-10 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629530652 NA 1.03E-07 mr1696_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629530652 NA 3.00E-09 mr1705_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629530652 NA 6.21E-07 mr1705_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629530652 NA 6.74E-08 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629530652 NA 4.80E-09 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629530652 NA 4.47E-10 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629530652 NA 2.68E-12 mr1993_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251