\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0629124144:

Variant ID: vg0629124144 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 29124144
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAAGGTGTTTTTCCAATGGCTTGTGTTTGGATTGGCCGACCTAAAAGGAGTTCTATTGGTTTCGGCTATGATAAATTCAGTAGGGTCTAGATTGCCGATT[G/A]
GACCGAGAAAGTATTGTTGGTCATGCAACAGACTGGGAACTGCAACAAGATTGGAAAGATGCTACAAGAATAGAGAAGGAGAAAACGGGATAAGGCGAGC

Reverse complement sequence

GCTCGCCTTATCCCGTTTTCTCCTTCTCTATTCTTGTAGCATCTTTCCAATCTTGTTGCAGTTCCCAGTCTGTTGCATGACCAACAATACTTTCTCGGTC[C/T]
AATCGGCAATCTAGACCCTACTGAATTTATCATAGCCGAAACCAATAGAACTCCTTTTAGGTCGGCCAATCCAAACACAAGCCATTGGAAAAACACCTTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.30% 4.60% 20.27% 5.86% NA
All Indica  2759 53.50% 7.70% 31.64% 7.14% NA
All Japonica  1512 97.40% 0.10% 1.39% 1.12% NA
Aus  269 78.10% 0.00% 8.18% 13.75% NA
Indica I  595 33.40% 10.60% 46.89% 9.08% NA
Indica II  465 26.70% 17.60% 43.66% 12.04% NA
Indica III  913 81.40% 1.40% 13.58% 3.61% NA
Indica Intermediate  786 52.30% 6.90% 33.97% 6.87% NA
Temperate Japonica  767 97.30% 0.00% 1.30% 1.43% NA
Tropical Japonica  504 97.60% 0.40% 1.19% 0.79% NA
Japonica Intermediate  241 97.10% 0.00% 2.07% 0.83% NA
VI/Aromatic  96 56.20% 0.00% 21.88% 21.88% NA
Intermediate  90 67.80% 3.30% 23.33% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0629124144 G -> A LOC_Os06g48130.1 downstream_gene_variant ; 3290.0bp to feature; MODIFIER silent_mutation Average:9.908; most accessible tissue: Callus, score: 15.286 N N N N
vg0629124144 G -> A LOC_Os06g48150.1 downstream_gene_variant ; 1903.0bp to feature; MODIFIER silent_mutation Average:9.908; most accessible tissue: Callus, score: 15.286 N N N N
vg0629124144 G -> A LOC_Os06g48140.1 intron_variant ; MODIFIER silent_mutation Average:9.908; most accessible tissue: Callus, score: 15.286 N N N N
vg0629124144 G -> DEL N N silent_mutation Average:9.908; most accessible tissue: Callus, score: 15.286 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0629124144 NA 3.31E-10 mr1065 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629124144 NA 9.25E-10 mr1067 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629124144 NA 4.79E-08 mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629124144 NA 2.61E-08 mr1078 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629124144 NA 3.92E-09 mr1087 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629124144 NA 3.07E-38 mr1091 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629124144 NA 4.50E-12 mr1091 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629124144 NA 1.12E-08 mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629124144 NA 6.25E-09 mr1108 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629124144 NA 9.99E-08 mr1110 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629124144 NA 3.56E-08 mr1112 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629124144 NA 2.50E-15 mr1218 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629124144 NA 3.42E-08 mr1218 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629124144 NA 5.21E-08 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629124144 1.45E-06 2.14E-29 mr1221 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629124144 NA 3.35E-09 mr1221 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629124144 NA 4.07E-08 mr1260 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629124144 3.70E-06 3.70E-06 mr1521 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629124144 NA 3.02E-15 mr1583 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629124144 NA 1.20E-12 mr1065_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629124144 NA 7.73E-09 mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629124144 NA 3.04E-10 mr1078_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629124144 NA 6.39E-10 mr1087_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629124144 NA 2.34E-12 mr1091_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629124144 NA 1.61E-06 mr1094_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629124144 NA 9.41E-09 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629124144 NA 5.09E-38 mr1110_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629124144 NA 3.48E-09 mr1110_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629124144 NA 3.20E-10 mr1112_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629124144 NA 8.86E-06 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629124144 NA 1.25E-19 mr1218_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629124144 NA 4.55E-08 mr1218_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629124144 NA 2.86E-09 mr1221_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629124144 NA 5.97E-10 mr1526_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251