Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0628931506:

Variant ID: vg0628931506 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 28931506
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGAAATTCAATGTACTCATTTAGATTGTGTTTAAATCTTCTGAAGATGAAAATAAAAATAAAGATTAAGTGTTTCACGTAAAACGAGGTGGTAATAACAT[G/A]
TGATTAATTAAGTTTTAATTATTACAAACTTAAAAATTGATTAATCTTATATTTTTTAAAAAACTTTATATGAAAGTTTTTTAACCGTTTGAAAAAATGC

Reverse complement sequence

GCATTTTTTCAAACGGTTAAAAAACTTTCATATAAAGTTTTTTAAAAAATATAAGATTAATCAATTTTTAAGTTTGTAATAATTAAAACTTAATTAATCA[C/T]
ATGTTATTACCACCTCGTTTTACGTGAAACACTTAATCTTTATTTTTATTTTCATCTTCAGAAGATTTAAACACAATCTAAATGAGTACATTGAATTTCT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.20%	30.10%	0.76%	0.00%	NA
All Indica	2759	90.40%	9.40%	0.22%	0.00%	NA
All Japonica	1512	24.40%	73.70%	1.92%	0.00%	NA
Aus	269	91.80%	8.20%	0.00%	0.00%	NA
Indica I	595	81.00%	18.30%	0.67%	0.00%	NA
Indica II	465	98.50%	1.50%	0.00%	0.00%	NA
Indica III	913	94.10%	5.90%	0.00%	0.00%	NA
Indica Intermediate	786	88.40%	11.30%	0.25%	0.00%	NA
Temperate Japonica	767	42.60%	54.80%	2.61%	0.00%	NA
Tropical Japonica	504	4.80%	94.20%	0.99%	0.00%	NA
Japonica Intermediate	241	7.50%	90.90%	1.66%	0.00%	NA
VI/Aromatic	96	93.80%	6.20%	0.00%	0.00%	NA
Intermediate	90	76.70%	22.20%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0628931506	G -> A	LOC_Os06g47800.1	upstream_gene_variant ; 1429.0bp to feature; MODIFIER	silent_mutation	Average:93.04; most accessible tissue: Callus, score: 98.745	N	N	N	N
vg0628931506	G -> A	LOC_Os06g47810.1	downstream_gene_variant ; 3710.0bp to feature; MODIFIER	silent_mutation	Average:93.04; most accessible tissue: Callus, score: 98.745	N	N	N	N
vg0628931506	G -> A	LOC_Os06g47800-LOC_Os06g47810	intergenic_region ; MODIFIER	silent_mutation	Average:93.04; most accessible tissue: Callus, score: 98.745	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0628931506	G	A	-0.01	-0.02	-0.03	-0.02	-0.03	-0.03

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0628931506	NA	3.94E-11	mr1010_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628931506	NA	1.76E-09	mr1051_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628931506	NA	7.84E-06	mr1164_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628931506	NA	1.30E-07	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628931506	NA	4.31E-07	mr1302_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628931506	NA	1.06E-06	mr1369_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628931506	NA	1.09E-06	mr1418_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628931506	NA	4.53E-07	mr1453_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628931506	NA	1.52E-06	mr1488_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628931506	NA	1.46E-09	mr1506_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628931506	NA	9.49E-07	mr1533_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628931506	NA	1.43E-07	mr1604_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628931506	NA	3.51E-07	mr1627_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628931506	NA	4.79E-07	mr1824_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628931506	NA	3.22E-07	mr1977_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251