\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0628931506:

Variant ID: vg0628931506 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 28931506
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGAAATTCAATGTACTCATTTAGATTGTGTTTAAATCTTCTGAAGATGAAAATAAAAATAAAGATTAAGTGTTTCACGTAAAACGAGGTGGTAATAACAT[G/A]
TGATTAATTAAGTTTTAATTATTACAAACTTAAAAATTGATTAATCTTATATTTTTTAAAAAACTTTATATGAAAGTTTTTTAACCGTTTGAAAAAATGC

Reverse complement sequence

GCATTTTTTCAAACGGTTAAAAAACTTTCATATAAAGTTTTTTAAAAAATATAAGATTAATCAATTTTTAAGTTTGTAATAATTAAAACTTAATTAATCA[C/T]
ATGTTATTACCACCTCGTTTTACGTGAAACACTTAATCTTTATTTTTATTTTCATCTTCAGAAGATTTAAACACAATCTAAATGAGTACATTGAATTTCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.20% 30.10% 0.76% 0.00% NA
All Indica  2759 90.40% 9.40% 0.22% 0.00% NA
All Japonica  1512 24.40% 73.70% 1.92% 0.00% NA
Aus  269 91.80% 8.20% 0.00% 0.00% NA
Indica I  595 81.00% 18.30% 0.67% 0.00% NA
Indica II  465 98.50% 1.50% 0.00% 0.00% NA
Indica III  913 94.10% 5.90% 0.00% 0.00% NA
Indica Intermediate  786 88.40% 11.30% 0.25% 0.00% NA
Temperate Japonica  767 42.60% 54.80% 2.61% 0.00% NA
Tropical Japonica  504 4.80% 94.20% 0.99% 0.00% NA
Japonica Intermediate  241 7.50% 90.90% 1.66% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 76.70% 22.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0628931506 G -> A LOC_Os06g47800.1 upstream_gene_variant ; 1429.0bp to feature; MODIFIER silent_mutation Average:93.04; most accessible tissue: Callus, score: 98.745 N N N N
vg0628931506 G -> A LOC_Os06g47810.1 downstream_gene_variant ; 3710.0bp to feature; MODIFIER silent_mutation Average:93.04; most accessible tissue: Callus, score: 98.745 N N N N
vg0628931506 G -> A LOC_Os06g47800-LOC_Os06g47810 intergenic_region ; MODIFIER silent_mutation Average:93.04; most accessible tissue: Callus, score: 98.745 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0628931506 G A -0.01 -0.02 -0.03 -0.02 -0.03 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0628931506 NA 3.94E-11 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628931506 NA 1.76E-09 mr1051_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628931506 NA 7.84E-06 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628931506 NA 1.30E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628931506 NA 4.31E-07 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628931506 NA 1.06E-06 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628931506 NA 1.09E-06 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628931506 NA 4.53E-07 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628931506 NA 1.52E-06 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628931506 NA 1.46E-09 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628931506 NA 9.49E-07 mr1533_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628931506 NA 1.43E-07 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628931506 NA 3.51E-07 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628931506 NA 4.79E-07 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628931506 NA 3.22E-07 mr1977_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251