\
| Variant ID: vg0628893075 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 28893075 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTAGTGAAAGTTTGATCCGGCGTGGACAAAATAGCAGAAAGGCTTCAGCGACGTCACTCGCTGTCACTTCGGCTTGTCTACATTTATAGCAAGTGGTTAA[G/A]
GAGTTTTTTATCCTGGCATATGGGTCGCGACCTAGTCTTCGGGTTGTAGGGCCTTGATGTTGCACGCTGGTATTTTTTTCTCTTTTTTTAGTGTGTTGGA
TCCAACACACTAAAAAAAGAGAAAAAAATACCAGCGTGCAACATCAAGGCCCTACAACCCGAAGACTAGGTCGCGACCCATATGCCAGGATAAAAAACTC[C/T]
TTAACCACTTGCTATAAATGTAGACAAGCCGAAGTGACAGCGAGTGACGTCGCTGAAGCCTTTCTGCTATTTTGTCCACGCCGGATCAAACTTTCACTAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.60% | 14.40% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 88.80% | 11.20% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 11.90% | 88.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 87.70% | 12.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.20% | 2.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 88.40% | 11.60% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 85.00% | 15.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 93.70% | 6.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.10% | 2.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 10.40% | 89.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0628893075 | G -> A | LOC_Os06g47740.1 | upstream_gene_variant ; 925.0bp to feature; MODIFIER | silent_mutation | Average:56.008; most accessible tissue: Minghui63 root, score: 86.877 | N | N | N | N |
| vg0628893075 | G -> A | LOC_Os06g47740-LOC_Os06g47750 | intergenic_region ; MODIFIER | silent_mutation | Average:56.008; most accessible tissue: Minghui63 root, score: 86.877 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0628893075 | NA | 3.00E-13 | mr1166 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628893075 | NA | 5.85E-13 | mr1231 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628893075 | NA | 8.73E-06 | mr1305 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628893075 | NA | 9.28E-20 | mr1515 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628893075 | NA | 6.15E-09 | mr1515 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628893075 | NA | 6.44E-09 | mr1585 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628893075 | NA | 3.88E-06 | mr1633 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628893075 | NA | 3.92E-08 | mr1669 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628893075 | NA | 2.39E-18 | mr1765 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628893075 | NA | 4.80E-07 | mr1923 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628893075 | NA | 9.01E-09 | mr1166_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |