\
| Variant ID: vg0628888899 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 28888899 |
| Reference Allele: T | Alternative Allele: A,C |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 281. )
ATCTTAAATCTTAGTCAGAATTCTTACCTTCCATATTATTGACTTTCTTGGCATAACATTCCTGTACATTAAAGATTTGTACATCGAATTTACTAAAAAA[T/A,C]
TATATTTCCACATGCTTTCCATCTCAATTGATTTGGATCGTTCCAGAGCTTTAGTCTGATCAGCCGATGAATTGGACGTTGTCGAGCCAACTGACAATAT
ATATTGTCAGTTGGCTCGACAACGTCCAATTCATCGGCTGATCAGACTAAAGCTCTGGAACGATCCAAATCAATTGAGATGGAAAGCATGTGGAAATATA[A/T,G]
TTTTTTAGTAAATTCGATGTACAAATCTTTAATGTACAGGAATGTTATGCCAAGAAAGTCAATAATATGGAAGGTAAGAATTCTGACTAAGATTTAAGAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 73.40% | 26.20% | 0.40% | 0.00% | NA |
| All Indica | 2759 | 97.20% | 2.70% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 25.20% | 73.60% | 1.19% | 0.00% | NA |
| Aus | 269 | 91.80% | 8.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 92.80% | 7.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.20% | 2.70% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 42.00% | 56.10% | 1.96% | 0.00% | NA |
| Tropical Japonica | 504 | 7.50% | 92.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 8.70% | 90.00% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 76.70% | 23.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0628888899 | T -> C | LOC_Os06g47730.1 | downstream_gene_variant ; 1898.0bp to feature; MODIFIER | N | Average:47.293; most accessible tissue: Callus, score: 70.731 | N | N | N | N |
| vg0628888899 | T -> C | LOC_Os06g47740.1 | downstream_gene_variant ; 60.0bp to feature; MODIFIER | N | Average:47.293; most accessible tissue: Callus, score: 70.731 | N | N | N | N |
| vg0628888899 | T -> C | LOC_Os06g47730-LOC_Os06g47740 | intergenic_region ; MODIFIER | N | Average:47.293; most accessible tissue: Callus, score: 70.731 | N | N | N | N |
| vg0628888899 | T -> A | LOC_Os06g47730.1 | downstream_gene_variant ; 1898.0bp to feature; MODIFIER | silent_mutation | Average:47.293; most accessible tissue: Callus, score: 70.731 | N | N | N | N |
| vg0628888899 | T -> A | LOC_Os06g47740.1 | downstream_gene_variant ; 60.0bp to feature; MODIFIER | silent_mutation | Average:47.293; most accessible tissue: Callus, score: 70.731 | N | N | N | N |
| vg0628888899 | T -> A | LOC_Os06g47730-LOC_Os06g47740 | intergenic_region ; MODIFIER | silent_mutation | Average:47.293; most accessible tissue: Callus, score: 70.731 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0628888899 | NA | 8.16E-11 | mr1138 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628888899 | NA | 4.10E-08 | mr1354 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628888899 | NA | 2.20E-14 | mr1449 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628888899 | NA | 3.73E-07 | mr1554 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628888899 | NA | 2.15E-23 | mr1627 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628888899 | NA | 3.00E-07 | mr1915 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628888899 | NA | 7.32E-16 | mr1968 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628888899 | 4.37E-07 | NA | mr1010_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628888899 | NA | 2.63E-12 | mr1010_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628888899 | NA | 1.45E-07 | mr1051_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628888899 | NA | 5.05E-07 | mr1418_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628888899 | NA | 4.88E-07 | mr1488_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628888899 | NA | 3.73E-10 | mr1506_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628888899 | NA | 3.71E-14 | mr1579_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628888899 | NA | 8.62E-22 | mr1627_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628888899 | NA | 5.00E-07 | mr1627_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628888899 | NA | 8.57E-08 | mr1668_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628888899 | NA | 8.15E-08 | mr1683_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628888899 | NA | 3.57E-09 | mr1851_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628888899 | NA | 1.79E-07 | mr1977_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |