\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0628888899:

Variant ID: vg0628888899 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 28888899
Reference Allele: TAlternative Allele: A,C
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:


ATCTTAAATCTTAGTCAGAATTCTTACCTTCCATATTATTGACTTTCTTGGCATAACATTCCTGTACATTAAAGATTTGTACATCGAATTTACTAAAAAA[T/A,C]
TATATTTCCACATGCTTTCCATCTCAATTGATTTGGATCGTTCCAGAGCTTTAGTCTGATCAGCCGATGAATTGGACGTTGTCGAGCCAACTGACAATAT

Reverse complement sequence

ATATTGTCAGTTGGCTCGACAACGTCCAATTCATCGGCTGATCAGACTAAAGCTCTGGAACGATCCAAATCAATTGAGATGGAAAGCATGTGGAAATATA[A/T,G]
TTTTTTAGTAAATTCGATGTACAAATCTTTAATGTACAGGAATGTTATGCCAAGAAAGTCAATAATATGGAAGGTAAGAATTCTGACTAAGATTTAAGAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.40% 26.20% 0.40% 0.00% NA
All Indica  2759 97.20% 2.70% 0.04% 0.00% NA
All Japonica  1512 25.20% 73.60% 1.19% 0.00% NA
Aus  269 91.80% 8.20% 0.00% 0.00% NA
Indica I  595 92.80% 7.20% 0.00% 0.00% NA
Indica II  465 98.50% 1.50% 0.00% 0.00% NA
Indica III  913 99.60% 0.40% 0.00% 0.00% NA
Indica Intermediate  786 97.20% 2.70% 0.13% 0.00% NA
Temperate Japonica  767 42.00% 56.10% 1.96% 0.00% NA
Tropical Japonica  504 7.50% 92.50% 0.00% 0.00% NA
Japonica Intermediate  241 8.70% 90.00% 1.24% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 76.70% 23.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0628888899 T -> C LOC_Os06g47730.1 downstream_gene_variant ; 1898.0bp to feature; MODIFIER N Average:47.293; most accessible tissue: Callus, score: 70.731 N N N N
vg0628888899 T -> C LOC_Os06g47740.1 downstream_gene_variant ; 60.0bp to feature; MODIFIER N Average:47.293; most accessible tissue: Callus, score: 70.731 N N N N
vg0628888899 T -> C LOC_Os06g47730-LOC_Os06g47740 intergenic_region ; MODIFIER N Average:47.293; most accessible tissue: Callus, score: 70.731 N N N N
vg0628888899 T -> A LOC_Os06g47730.1 downstream_gene_variant ; 1898.0bp to feature; MODIFIER silent_mutation Average:47.293; most accessible tissue: Callus, score: 70.731 N N N N
vg0628888899 T -> A LOC_Os06g47740.1 downstream_gene_variant ; 60.0bp to feature; MODIFIER silent_mutation Average:47.293; most accessible tissue: Callus, score: 70.731 N N N N
vg0628888899 T -> A LOC_Os06g47730-LOC_Os06g47740 intergenic_region ; MODIFIER silent_mutation Average:47.293; most accessible tissue: Callus, score: 70.731 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0628888899 NA 8.16E-11 mr1138 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628888899 NA 4.10E-08 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628888899 NA 2.20E-14 mr1449 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628888899 NA 3.73E-07 mr1554 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628888899 NA 2.15E-23 mr1627 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628888899 NA 3.00E-07 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628888899 NA 7.32E-16 mr1968 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628888899 4.37E-07 NA mr1010_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628888899 NA 2.63E-12 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628888899 NA 1.45E-07 mr1051_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628888899 NA 5.05E-07 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628888899 NA 4.88E-07 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628888899 NA 3.73E-10 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628888899 NA 3.71E-14 mr1579_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628888899 NA 8.62E-22 mr1627_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628888899 NA 5.00E-07 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628888899 NA 8.57E-08 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628888899 NA 8.15E-08 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628888899 NA 3.57E-09 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628888899 NA 1.79E-07 mr1977_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251