Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0628888899:

Variant ID: vg0628888899 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 28888899
Reference Allele: T	Alternative Allele: A,C
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:

ATCTTAAATCTTAGTCAGAATTCTTACCTTCCATATTATTGACTTTCTTGGCATAACATTCCTGTACATTAAAGATTTGTACATCGAATTTACTAAAAAA[T/A,C]
TATATTTCCACATGCTTTCCATCTCAATTGATTTGGATCGTTCCAGAGCTTTAGTCTGATCAGCCGATGAATTGGACGTTGTCGAGCCAACTGACAATAT

Reverse complement sequence

ATATTGTCAGTTGGCTCGACAACGTCCAATTCATCGGCTGATCAGACTAAAGCTCTGGAACGATCCAAATCAATTGAGATGGAAAGCATGTGGAAATATA[A/T,G]
TTTTTTAGTAAATTCGATGTACAAATCTTTAATGTACAGGAATGTTATGCCAAGAAAGTCAATAATATGGAAGGTAAGAATTCTGACTAAGATTTAAGAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.40%	26.20%	0.40%	0.00%	NA
All Indica	2759	97.20%	2.70%	0.04%	0.00%	NA
All Japonica	1512	25.20%	73.60%	1.19%	0.00%	NA
Aus	269	91.80%	8.20%	0.00%	0.00%	NA
Indica I	595	92.80%	7.20%	0.00%	0.00%	NA
Indica II	465	98.50%	1.50%	0.00%	0.00%	NA
Indica III	913	99.60%	0.40%	0.00%	0.00%	NA
Indica Intermediate	786	97.20%	2.70%	0.13%	0.00%	NA
Temperate Japonica	767	42.00%	56.10%	1.96%	0.00%	NA
Tropical Japonica	504	7.50%	92.50%	0.00%	0.00%	NA
Japonica Intermediate	241	8.70%	90.00%	1.24%	0.00%	NA
VI/Aromatic	96	94.80%	5.20%	0.00%	0.00%	NA
Intermediate	90	76.70%	23.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0628888899	T -> C	LOC_Os06g47730.1	downstream_gene_variant ; 1898.0bp to feature; MODIFIER	N	Average:47.293; most accessible tissue: Callus, score: 70.731	N	N	N	N
vg0628888899	T -> C	LOC_Os06g47740.1	downstream_gene_variant ; 60.0bp to feature; MODIFIER	N	Average:47.293; most accessible tissue: Callus, score: 70.731	N	N	N	N
vg0628888899	T -> C	LOC_Os06g47730-LOC_Os06g47740	intergenic_region ; MODIFIER	N	Average:47.293; most accessible tissue: Callus, score: 70.731	N	N	N	N
vg0628888899	T -> A	LOC_Os06g47730.1	downstream_gene_variant ; 1898.0bp to feature; MODIFIER	silent_mutation	Average:47.293; most accessible tissue: Callus, score: 70.731	N	N	N	N
vg0628888899	T -> A	LOC_Os06g47740.1	downstream_gene_variant ; 60.0bp to feature; MODIFIER	silent_mutation	Average:47.293; most accessible tissue: Callus, score: 70.731	N	N	N	N
vg0628888899	T -> A	LOC_Os06g47730-LOC_Os06g47740	intergenic_region ; MODIFIER	silent_mutation	Average:47.293; most accessible tissue: Callus, score: 70.731	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0628888899	NA	8.16E-11	mr1138	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628888899	NA	4.10E-08	mr1354	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628888899	NA	2.20E-14	mr1449	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628888899	NA	3.73E-07	mr1554	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628888899	NA	2.15E-23	mr1627	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628888899	NA	3.00E-07	mr1915	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628888899	NA	7.32E-16	mr1968	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628888899	4.37E-07	NA	mr1010_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628888899	NA	2.63E-12	mr1010_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628888899	NA	1.45E-07	mr1051_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628888899	NA	5.05E-07	mr1418_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628888899	NA	4.88E-07	mr1488_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628888899	NA	3.73E-10	mr1506_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628888899	NA	3.71E-14	mr1579_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628888899	NA	8.62E-22	mr1627_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628888899	NA	5.00E-07	mr1627_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628888899	NA	8.57E-08	mr1668_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628888899	NA	8.15E-08	mr1683_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628888899	NA	3.57E-09	mr1851_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628888899	NA	1.79E-07	mr1977_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251