Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0628766795:

Variant ID: vg0628766795 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 28766795
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAGATCGGCTGAAACTCCGATACTACCCTAATCGGCAACCATAAAGCAGGCTAGAGATTGCAAATCTAAGCACGACTTAATAGATCAAACTCAACTGATG[T/C]
AGCATTAAGTATGAAAAGAAGAACAATATCTAAACAATTAAGCCGCTGGAAGTTTCATAGAGTGGTAGATATATCACATAATCTAAGTTAACATCATTGT

Reverse complement sequence

ACAATGATGTTAACTTAGATTATGTGATATATCTACCACTCTATGAAACTTCCAGCGGCTTAATTGTTTAGATATTGTTCTTCTTTTCATACTTAATGCT[A/G]
CATCAGTTGAGTTTGATCTATTAAGTCGTGCTTAGATTTGCAATCTCTAGCCTGCTTTATGGTTGCCGATTAGGGTAGTATCGGAGTTTCAGCCGATCTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.90%	31.70%	0.38%	0.00%	NA
All Indica	2759	96.80%	3.20%	0.00%	0.00%	NA
All Japonica	1512	9.30%	89.60%	1.12%	0.00%	NA
Aus	269	90.70%	8.90%	0.37%	0.00%	NA
Indica I	595	91.30%	8.70%	0.00%	0.00%	NA
Indica II	465	98.30%	1.70%	0.00%	0.00%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	96.80%	3.20%	0.00%	0.00%	NA
Temperate Japonica	767	8.20%	90.00%	1.83%	0.00%	NA
Tropical Japonica	504	7.50%	92.50%	0.00%	0.00%	NA
Japonica Intermediate	241	16.60%	82.20%	1.24%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	64.40%	35.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0628766795	T -> C	LOC_Os06g47500.1	upstream_gene_variant ; 3925.0bp to feature; MODIFIER	silent_mutation	Average:29.368; most accessible tissue: Minghui63 panicle, score: 68.46	N	N	N	N
vg0628766795	T -> C	LOC_Os06g47510.1	upstream_gene_variant ; 785.0bp to feature; MODIFIER	silent_mutation	Average:29.368; most accessible tissue: Minghui63 panicle, score: 68.46	N	N	N	N
vg0628766795	T -> C	LOC_Os06g47520.1	upstream_gene_variant ; 1699.0bp to feature; MODIFIER	silent_mutation	Average:29.368; most accessible tissue: Minghui63 panicle, score: 68.46	N	N	N	N
vg0628766795	T -> C	LOC_Os06g47530.1	downstream_gene_variant ; 2710.0bp to feature; MODIFIER	silent_mutation	Average:29.368; most accessible tissue: Minghui63 panicle, score: 68.46	N	N	N	N
vg0628766795	T -> C	LOC_Os06g47510-LOC_Os06g47520	intergenic_region ; MODIFIER	silent_mutation	Average:29.368; most accessible tissue: Minghui63 panicle, score: 68.46	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0628766795	9.32E-06	NA	mr1114	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628766795	2.70E-06	NA	mr1117	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628766795	NA	2.96E-06	mr1118	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628766795	NA	3.05E-07	mr1123	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628766795	2.16E-07	NA	mr1240	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628766795	NA	6.49E-07	mr1240	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628766795	NA	4.15E-06	mr1242	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628766795	3.64E-06	NA	mr1247	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628766795	NA	5.39E-06	mr1247	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628766795	NA	3.68E-08	mr1495	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628766795	8.36E-06	NA	mr1496	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628766795	NA	5.12E-06	mr1496	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628766795	NA	1.46E-06	mr1858	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628766795	NA	1.46E-06	mr1859	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628766795	NA	3.09E-07	mr1936	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628766795	4.05E-06	NA	mr1117_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628766795	NA	2.96E-06	mr1117_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628766795	8.16E-06	4.36E-08	mr1118_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628766795	NA	8.38E-06	mr1120_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628766795	NA	3.94E-07	mr1123_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628766795	NA	5.63E-06	mr1150_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628766795	4.47E-06	1.72E-07	mr1240_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628766795	NA	5.27E-07	mr1242_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628766795	NA	3.61E-07	mr1496_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628766795	NA	2.79E-06	mr1936_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251