\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0628759426:

Variant ID: vg0628759426 (JBrowse)Variation Type: INDEL
Chromosome: chr06Position: 28759426
Reference Allele: TAAlternative Allele: GA,T
Primary Allele: TASecondary Allele: GA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGGGAGACCGCCGCCATGATGGCCCGATGAGAACTAGAGGACAGCCAGCTTATAAACACCTAGCGAGCTGAATTCCAATATATCTATAAGTATGTTTTTT[TA/GA,T]
GATAATAAAATATAATATCCTGGCCTTTGCTCAAATATCTTATAAGTATGTAACTGTTCCAATTGTAATTATACTGAAAATCATTCGTGTGGGTAAGAAT

Reverse complement sequence

ATTCTTACCCACACGAATGATTTTCAGTATAATTACAATTGGAACAGTTACATACTTATAAGATATTTGAGCAAAGGCCAGGATATTATATTTTATTATC[TA/TC,A]
AAAAAACATACTTATAGATATATTGGAATTCAGCTCGCTAGGTGTTTATAAGCTGGCTGTCCTCTAGTTCTCATCGGGCCATCATGGCGGCGGTCTCCCG

Allele Frequencies:

Populations Population SizeFrequency of TA(primary allele) Frequency of GA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.70% 1.70% 0.49% 0.08% T: 0.02%
All Indica  2759 99.70% 0.00% 0.11% 0.14% NA
All Japonica  1512 93.60% 5.10% 1.32% 0.00% NA
Aus  269 99.60% 0.00% 0.00% 0.00% T: 0.37%
Indica I  595 99.80% 0.00% 0.00% 0.17% NA
Indica II  465 99.80% 0.00% 0.22% 0.00% NA
Indica III  913 99.90% 0.00% 0.11% 0.00% NA
Indica Intermediate  786 99.40% 0.10% 0.13% 0.38% NA
Temperate Japonica  767 92.80% 5.10% 2.09% 0.00% NA
Tropical Japonica  504 98.20% 1.80% 0.00% 0.00% NA
Japonica Intermediate  241 86.30% 12.00% 1.66% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0628759426 TA -> T LOC_Os06g47470.1 upstream_gene_variant ; 2017.0bp to feature; MODIFIER silent_mutation Average:80.795; most accessible tissue: Minghui63 root, score: 93.758 N N N N
vg0628759426 TA -> T LOC_Os06g47490.1 upstream_gene_variant ; 522.0bp to feature; MODIFIER silent_mutation Average:80.795; most accessible tissue: Minghui63 root, score: 93.758 N N N N
vg0628759426 TA -> T LOC_Os06g47480.1 downstream_gene_variant ; 52.0bp to feature; MODIFIER silent_mutation Average:80.795; most accessible tissue: Minghui63 root, score: 93.758 N N N N
vg0628759426 TA -> T LOC_Os06g47500.1 downstream_gene_variant ; 2933.0bp to feature; MODIFIER silent_mutation Average:80.795; most accessible tissue: Minghui63 root, score: 93.758 N N N N
vg0628759426 TA -> T LOC_Os06g47510.1 downstream_gene_variant ; 3627.0bp to feature; MODIFIER silent_mutation Average:80.795; most accessible tissue: Minghui63 root, score: 93.758 N N N N
vg0628759426 TA -> T LOC_Os06g47480-LOC_Os06g47490 intergenic_region ; MODIFIER silent_mutation Average:80.795; most accessible tissue: Minghui63 root, score: 93.758 N N N N
vg0628759426 TA -> DEL N N silent_mutation Average:80.795; most accessible tissue: Minghui63 root, score: 93.758 N N N N
vg0628759426 TA -> GA LOC_Os06g47470.1 upstream_gene_variant ; 2016.0bp to feature; MODIFIER silent_mutation Average:80.795; most accessible tissue: Minghui63 root, score: 93.758 N N N N
vg0628759426 TA -> GA LOC_Os06g47490.1 upstream_gene_variant ; 523.0bp to feature; MODIFIER silent_mutation Average:80.795; most accessible tissue: Minghui63 root, score: 93.758 N N N N
vg0628759426 TA -> GA LOC_Os06g47480.1 downstream_gene_variant ; 51.0bp to feature; MODIFIER silent_mutation Average:80.795; most accessible tissue: Minghui63 root, score: 93.758 N N N N
vg0628759426 TA -> GA LOC_Os06g47500.1 downstream_gene_variant ; 2934.0bp to feature; MODIFIER silent_mutation Average:80.795; most accessible tissue: Minghui63 root, score: 93.758 N N N N
vg0628759426 TA -> GA LOC_Os06g47510.1 downstream_gene_variant ; 3628.0bp to feature; MODIFIER silent_mutation Average:80.795; most accessible tissue: Minghui63 root, score: 93.758 N N N N
vg0628759426 TA -> GA LOC_Os06g47480-LOC_Os06g47490 intergenic_region ; MODIFIER silent_mutation Average:80.795; most accessible tissue: Minghui63 root, score: 93.758 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0628759426 TA GA -0.01 -0.01 -0.01 -0.01 -0.01 -0.01
vg0628759426 TA T -0.03 0.0 0.02 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0628759426 4.33E-08 4.33E-08 mr1098 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426 2.84E-06 2.84E-06 mr1099 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426 NA 2.60E-08 mr1101 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426 NA 8.10E-06 mr1114 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426 NA 1.43E-07 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426 NA 2.96E-09 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426 NA 5.47E-06 mr1119 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426 NA 1.55E-06 mr1120 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426 2.17E-07 1.74E-10 mr1123 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426 NA 2.42E-06 mr1150 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426 6.55E-06 3.99E-07 mr1239 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426 4.89E-07 2.00E-09 mr1240 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426 NA 7.98E-09 mr1242 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426 1.66E-07 1.36E-09 mr1247 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426 NA 5.46E-06 mr1441 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426 1.98E-06 2.87E-10 mr1495 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426 NA 1.83E-07 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426 4.11E-06 4.11E-06 mr1589 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426 9.98E-08 3.35E-10 mr1858 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426 9.98E-08 3.35E-10 mr1859 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426 3.19E-06 3.19E-06 mr1868 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426 NA 1.86E-07 mr1917 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426 NA 1.45E-07 mr1936 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426 3.65E-06 1.02E-07 mr1098_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426 NA 9.57E-07 mr1113_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426 5.98E-07 1.09E-08 mr1114_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426 8.43E-07 1.69E-08 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426 1.50E-06 7.92E-10 mr1118_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426 8.05E-06 1.17E-07 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426 2.63E-06 3.39E-08 mr1120_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426 1.59E-06 3.27E-09 mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426 6.97E-07 3.20E-09 mr1150_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426 2.48E-08 6.68E-11 mr1240_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426 2.24E-06 1.38E-08 mr1242_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426 4.61E-06 4.61E-06 mr1244_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426 NA 2.71E-07 mr1247_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426 1.75E-06 4.68E-09 mr1495_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426 1.74E-06 1.65E-08 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426 4.73E-06 4.16E-08 mr1936_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251