\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0628752358:

Variant ID: vg0628752358 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 28752358
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAGATTAACTTGTTTAAGCGTCTATAAGTACCTTGAACAAATACTTTAGAAGACGTGTCTTTTGAATTAGTACAATTTACAGAATTTGTCAACCTATAG[A/G]
AAAATTACGAAATTTATGTAAGGCATAATTTTTTAGGCTAATGACTCTAATTGTCAGCTTAATATGCAGAGCCAGTCTTTGTATTAAAAGATTACTCTTT

Reverse complement sequence

AAAGAGTAATCTTTTAATACAAAGACTGGCTCTGCATATTAAGCTGACAATTAGAGTCATTAGCCTAAAAAATTATGCCTTACATAAATTTCGTAATTTT[T/C]
CTATAGGTTGACAAATTCTGTAAATTGTACTAATTCAAAAGACACGTCTTCTAAAGTATTTGTTCAAGGTACTTATAGACGCTTAAACAAGTTAATCTTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.20% 34.20% 4.91% 14.68% NA
All Indica  2759 77.20% 3.70% 2.68% 16.42% NA
All Japonica  1512 0.50% 96.00% 0.13% 3.37% NA
Aus  269 3.70% 8.60% 56.88% 30.86% NA
Indica I  595 68.40% 9.20% 1.51% 20.84% NA
Indica II  465 77.40% 2.20% 4.30% 16.13% NA
Indica III  913 84.20% 0.90% 2.30% 12.60% NA
Indica Intermediate  786 75.70% 3.60% 3.05% 17.68% NA
Temperate Japonica  767 0.40% 97.00% 0.00% 2.61% NA
Tropical Japonica  504 0.40% 94.20% 0.20% 5.16% NA
Japonica Intermediate  241 1.20% 96.30% 0.41% 2.07% NA
VI/Aromatic  96 8.30% 4.20% 3.12% 84.38% NA
Intermediate  90 30.00% 41.10% 0.00% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0628752358 A -> G LOC_Os06g47470.1 downstream_gene_variant ; 191.0bp to feature; MODIFIER silent_mutation Average:21.506; most accessible tissue: Zhenshan97 panicle, score: 32.308 N N N N
vg0628752358 A -> G LOC_Os06g47460-LOC_Os06g47470 intergenic_region ; MODIFIER silent_mutation Average:21.506; most accessible tissue: Zhenshan97 panicle, score: 32.308 N N N N
vg0628752358 A -> DEL N N silent_mutation Average:21.506; most accessible tissue: Zhenshan97 panicle, score: 32.308 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0628752358 NA 9.84E-36 mr1105 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628752358 NA 1.15E-10 mr1172 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628752358 NA 5.67E-44 mr1194 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628752358 2.08E-06 1.84E-46 mr1480 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628752358 NA 2.67E-21 mr1627 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628752358 NA 2.14E-14 mr1653 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628752358 5.55E-07 3.75E-57 mr1692 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628752358 NA 3.15E-18 mr1715 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628752358 NA 2.38E-20 mr1838 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628752358 NA 3.75E-22 mr1839 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628752358 NA 3.53E-20 mr1968 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628752358 NA 1.23E-31 mr1105_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628752358 NA 2.51E-09 mr1232_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628752358 NA 4.94E-24 mr1350_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628752358 NA 8.55E-56 mr1480_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628752358 NA 2.01E-09 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628752358 NA 4.39E-16 mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628752358 NA 5.31E-25 mr1653_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628752358 NA 8.89E-08 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628752358 NA 2.32E-13 mr1838_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628752358 NA 2.61E-24 mr1968_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628752358 NA 1.30E-10 mr1986_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251