\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0628741924:

Variant ID: vg0628741924 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 28741924
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAACGAGTCCTGACACAGGGGCTATGAAAATACCACACACTACTGCATTGTACAACTTTATGGACTAGATGTTGCGAGTCGACATGAGACAGGACGAAGT[T/C]
GAAGAGGGAGGAGGCGAGAGGAGGTGTAAGTCATCCCCAAGGCCGTCGCAGCATTGCCGGAGGGCAGCGTCTGCTGCCACGCGGAGGTGCACCCCATCGA

Reverse complement sequence

TCGATGGGGTGCACCTCCGCGTGGCAGCAGACGCTGCCCTCCGGCAATGCTGCGACGGCCTTGGGGATGACTTACACCTCCTCTCGCCTCCTCCCTCTTC[A/G]
ACTTCGTCCTGTCTCATGTCGACTCGCAACATCTAGTCCATAAAGTTGTACAATGCAGTAGTGTGTGGTATTTTCATAGCCCCTGTGTCAGGACTCGTTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 32.80% 1.80% 0.95% 64.45% NA
All Indica  2759 4.70% 0.10% 0.98% 94.24% NA
All Japonica  1512 89.60% 5.40% 1.06% 3.97% NA
Aus  269 9.30% 0.00% 0.00% 90.71% NA
Indica I  595 11.10% 0.00% 0.84% 88.07% NA
Indica II  465 3.00% 0.00% 0.22% 96.77% NA
Indica III  913 1.10% 0.10% 0.99% 97.81% NA
Indica Intermediate  786 5.10% 0.10% 1.53% 93.26% NA
Temperate Japonica  767 90.10% 5.30% 1.69% 2.87% NA
Tropical Japonica  504 92.70% 1.80% 0.00% 5.56% NA
Japonica Intermediate  241 81.70% 12.90% 1.24% 4.15% NA
VI/Aromatic  96 3.10% 0.00% 1.04% 95.83% NA
Intermediate  90 41.10% 2.20% 1.11% 55.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0628741924 T -> C LOC_Os06g47440.1 upstream_gene_variant ; 3304.0bp to feature; MODIFIER silent_mutation Average:19.819; most accessible tissue: Callus, score: 48.81 N N N N
vg0628741924 T -> C LOC_Os06g47460.1 upstream_gene_variant ; 1015.0bp to feature; MODIFIER silent_mutation Average:19.819; most accessible tissue: Callus, score: 48.81 N N N N
vg0628741924 T -> C LOC_Os06g47450.1 downstream_gene_variant ; 420.0bp to feature; MODIFIER silent_mutation Average:19.819; most accessible tissue: Callus, score: 48.81 N N N N
vg0628741924 T -> C LOC_Os06g47440-LOC_Os06g47450 intergenic_region ; MODIFIER silent_mutation Average:19.819; most accessible tissue: Callus, score: 48.81 N N N N
vg0628741924 T -> DEL N N silent_mutation Average:19.819; most accessible tissue: Callus, score: 48.81 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0628741924 4.57E-08 4.57E-08 mr1098 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628741924 3.03E-06 3.03E-06 mr1099 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628741924 NA 2.47E-08 mr1101 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628741924 NA 6.52E-06 mr1114 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628741924 NA 1.11E-07 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628741924 9.46E-06 2.80E-09 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628741924 NA 4.21E-06 mr1119 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628741924 NA 1.53E-06 mr1120 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628741924 2.66E-07 2.23E-10 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628741924 NA 2.35E-06 mr1150 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628741924 6.22E-06 3.73E-07 mr1239 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628741924 4.62E-07 1.71E-09 mr1240 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628741924 NA 8.80E-09 mr1242 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628741924 1.61E-07 1.17E-09 mr1247 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628741924 NA 8.23E-06 mr1441 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628741924 2.10E-06 3.77E-10 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628741924 NA 1.72E-07 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628741924 4.72E-06 4.72E-06 mr1589 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628741924 1.24E-07 3.44E-10 mr1858 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628741924 1.24E-07 3.43E-10 mr1859 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628741924 3.13E-06 3.13E-06 mr1868 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628741924 NA 1.75E-07 mr1917 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628741924 NA 1.71E-07 mr1936 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628741924 7.15E-06 1.47E-07 mr1098_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628741924 NA 9.42E-07 mr1113_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628741924 6.92E-07 9.68E-09 mr1114_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628741924 9.77E-07 1.64E-08 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628741924 2.19E-06 1.09E-09 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628741924 9.79E-06 1.15E-07 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628741924 2.84E-06 3.18E-08 mr1120_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628741924 2.48E-06 4.79E-09 mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628741924 1.35E-06 4.58E-09 mr1150_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628741924 3.25E-08 7.21E-11 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628741924 3.21E-06 1.77E-08 mr1242_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628741924 5.69E-06 5.69E-06 mr1244_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628741924 NA 3.02E-07 mr1247_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628741924 2.76E-06 7.54E-09 mr1495_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628741924 2.17E-06 1.91E-08 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628741924 8.31E-06 6.69E-08 mr1936_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251