Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0628726342:

Variant ID: vg0628726342 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 28726342
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.87, G: 0.13, others allele: 0.00, population size: 78. )

Flanking Sequence (100 bp) in Reference Genome:

AGCTTCTCCTCCGCCTCCCGCGCCCAGGACGGCGACAGCCGCAGCGCACGCATCAGGCGGTCGCAGCGTTTCCATCTCAATGTTTCAGTTCCAGACAAAC[A/G]
CTGCGATGGCGAGCACAGCGGCAGCAACAACAAGTGAGCAGTTCCCACCGGCGGCCATGGGGCCCGTCGCCGCTGCGCCGTTGCTGGAAGAACCGTCGTA

Reverse complement sequence

TACGACGGTTCTTCCAGCAACGGCGCAGCGGCGACGGGCCCCATGGCCGCCGGTGGGAACTGCTCACTTGTTGTTGCTGCCGCTGTGCTCGCCATCGCAG[T/C]
GTTTGTCTGGAACTGAAACATTGAGATGGAAACGCTGCGACCGCCTGATGCGTGCGCTGCGGCTGTCGCCGTCCTGGGCGCGGGAGGCGGAGGAGAAGCT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	34.70%	2.50%	1.25%	61.62%	NA
All Indica	2759	4.10%	4.20%	1.96%	89.74%	NA
All Japonica	1512	96.20%	0.00%	0.00%	3.84%	NA
Aus	269	9.70%	0.40%	0.74%	89.22%	NA
Indica I	595	9.90%	0.80%	1.01%	88.24%	NA
Indica II	465	2.80%	0.20%	0.65%	96.34%	NA
Indica III	913	1.10%	7.90%	3.50%	87.51%	NA
Indica Intermediate	786	4.10%	4.70%	1.65%	89.57%	NA
Temperate Japonica	767	97.40%	0.00%	0.00%	2.61%	NA
Tropical Japonica	504	94.40%	0.00%	0.00%	5.56%	NA
Japonica Intermediate	241	95.90%	0.00%	0.00%	4.15%	NA
VI/Aromatic	96	6.20%	1.00%	1.04%	91.67%	NA
Intermediate	90	42.20%	0.00%	2.22%	55.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0628726342	A -> G	LOC_Os06g47390.1	upstream_gene_variant ; 4757.0bp to feature; MODIFIER	silent_mutation	Average:16.49; most accessible tissue: Zhenshan97 root, score: 23.888	N	N	N	N
vg0628726342	A -> G	LOC_Os06g47400.1	upstream_gene_variant ; 1986.0bp to feature; MODIFIER	silent_mutation	Average:16.49; most accessible tissue: Zhenshan97 root, score: 23.888	N	N	N	N
vg0628726342	A -> G	LOC_Os06g47420.1	downstream_gene_variant ; 303.0bp to feature; MODIFIER	silent_mutation	Average:16.49; most accessible tissue: Zhenshan97 root, score: 23.888	N	N	N	N
vg0628726342	A -> G	LOC_Os06g47410.1	intron_variant ; MODIFIER	silent_mutation	Average:16.49; most accessible tissue: Zhenshan97 root, score: 23.888	N	N	N	N
vg0628726342	A -> DEL	N	N	silent_mutation	Average:16.49; most accessible tissue: Zhenshan97 root, score: 23.888	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0628726342	NA	7.14E-42	mr1480	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628726342	NA	1.52E-50	mr1692	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628726342	NA	6.65E-18	mr1968	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628726342	NA	1.59E-11	mr1138_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628726342	NA	6.63E-52	mr1480_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628726342	NA	1.42E-07	mr1681_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628726342	NA	2.56E-22	mr1968_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251