\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0628726342:

Variant ID: vg0628726342 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 28726342
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.87, G: 0.13, others allele: 0.00, population size: 78. )

Flanking Sequence (100 bp) in Reference Genome:


AGCTTCTCCTCCGCCTCCCGCGCCCAGGACGGCGACAGCCGCAGCGCACGCATCAGGCGGTCGCAGCGTTTCCATCTCAATGTTTCAGTTCCAGACAAAC[A/G]
CTGCGATGGCGAGCACAGCGGCAGCAACAACAAGTGAGCAGTTCCCACCGGCGGCCATGGGGCCCGTCGCCGCTGCGCCGTTGCTGGAAGAACCGTCGTA

Reverse complement sequence

TACGACGGTTCTTCCAGCAACGGCGCAGCGGCGACGGGCCCCATGGCCGCCGGTGGGAACTGCTCACTTGTTGTTGCTGCCGCTGTGCTCGCCATCGCAG[T/C]
GTTTGTCTGGAACTGAAACATTGAGATGGAAACGCTGCGACCGCCTGATGCGTGCGCTGCGGCTGTCGCCGTCCTGGGCGCGGGAGGCGGAGGAGAAGCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.70% 2.50% 1.25% 61.62% NA
All Indica  2759 4.10% 4.20% 1.96% 89.74% NA
All Japonica  1512 96.20% 0.00% 0.00% 3.84% NA
Aus  269 9.70% 0.40% 0.74% 89.22% NA
Indica I  595 9.90% 0.80% 1.01% 88.24% NA
Indica II  465 2.80% 0.20% 0.65% 96.34% NA
Indica III  913 1.10% 7.90% 3.50% 87.51% NA
Indica Intermediate  786 4.10% 4.70% 1.65% 89.57% NA
Temperate Japonica  767 97.40% 0.00% 0.00% 2.61% NA
Tropical Japonica  504 94.40% 0.00% 0.00% 5.56% NA
Japonica Intermediate  241 95.90% 0.00% 0.00% 4.15% NA
VI/Aromatic  96 6.20% 1.00% 1.04% 91.67% NA
Intermediate  90 42.20% 0.00% 2.22% 55.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0628726342 A -> G LOC_Os06g47390.1 upstream_gene_variant ; 4757.0bp to feature; MODIFIER silent_mutation Average:16.49; most accessible tissue: Zhenshan97 root, score: 23.888 N N N N
vg0628726342 A -> G LOC_Os06g47400.1 upstream_gene_variant ; 1986.0bp to feature; MODIFIER silent_mutation Average:16.49; most accessible tissue: Zhenshan97 root, score: 23.888 N N N N
vg0628726342 A -> G LOC_Os06g47420.1 downstream_gene_variant ; 303.0bp to feature; MODIFIER silent_mutation Average:16.49; most accessible tissue: Zhenshan97 root, score: 23.888 N N N N
vg0628726342 A -> G LOC_Os06g47410.1 intron_variant ; MODIFIER silent_mutation Average:16.49; most accessible tissue: Zhenshan97 root, score: 23.888 N N N N
vg0628726342 A -> DEL N N silent_mutation Average:16.49; most accessible tissue: Zhenshan97 root, score: 23.888 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0628726342 NA 7.14E-42 mr1480 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628726342 NA 1.52E-50 mr1692 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628726342 NA 6.65E-18 mr1968 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628726342 NA 1.59E-11 mr1138_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628726342 NA 6.63E-52 mr1480_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628726342 NA 1.42E-07 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628726342 NA 2.56E-22 mr1968_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251