\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0628725900:

Variant ID: vg0628725900 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 28725900
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAGTACACCAAAGGTCCCTCAACTTGTCATCAAGTTACAAAATCGTCCCGACCACAAAACTAGATATCGGCCGTCCCTTAACTAATCAAAATCGGTCACA[G/A]
TAGGCCCTTTGGTGGTGTTGACCCCGGTTTTGTCCTACGTGGCGACTGAGTCAGCGTGGGACCCACGAGTCAGGATGCCACGTCATCTATCTCCTTCCTC

Reverse complement sequence

GAGGAAGGAGATAGATGACGTGGCATCCTGACTCGTGGGTCCCACGCTGACTCAGTCGCCACGTAGGACAAAACCGGGGTCAACACCACCAAAGGGCCTA[C/T]
TGTGACCGATTTTGATTAGTTAAGGGACGGCCGATATCTAGTTTTGTGGTCGGGACGATTTTGTAACTTGATGACAAGTTGAGGGACCTTTGGTGTACTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 22.50% 8.80% 5.44% 63.29% NA
All Indica  2759 1.50% 1.90% 2.54% 94.02% NA
All Japonica  1512 64.20% 23.50% 8.66% 3.64% NA
Aus  269 8.60% 0.40% 15.24% 75.84% NA
Indica I  595 0.70% 7.20% 3.36% 88.74% NA
Indica II  465 1.50% 0.90% 0.00% 97.63% NA
Indica III  913 0.90% 0.10% 2.96% 96.06% NA
Indica Intermediate  786 2.90% 0.60% 2.93% 93.51% NA
Temperate Japonica  767 41.30% 43.40% 12.65% 2.61% NA
Tropical Japonica  504 90.50% 2.00% 2.38% 5.16% NA
Japonica Intermediate  241 82.20% 5.00% 9.13% 3.73% NA
VI/Aromatic  96 3.10% 0.00% 7.29% 89.58% NA
Intermediate  90 25.60% 7.80% 8.89% 57.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0628725900 G -> A LOC_Os06g47390.1 upstream_gene_variant ; 4315.0bp to feature; MODIFIER silent_mutation Average:72.14; most accessible tissue: Zhenshan97 panicle, score: 87.126 N N N N
vg0628725900 G -> A LOC_Os06g47400.1 upstream_gene_variant ; 1544.0bp to feature; MODIFIER silent_mutation Average:72.14; most accessible tissue: Zhenshan97 panicle, score: 87.126 N N N N
vg0628725900 G -> A LOC_Os06g47420.1 downstream_gene_variant ; 745.0bp to feature; MODIFIER silent_mutation Average:72.14; most accessible tissue: Zhenshan97 panicle, score: 87.126 N N N N
vg0628725900 G -> A LOC_Os06g47410.1 intron_variant ; MODIFIER silent_mutation Average:72.14; most accessible tissue: Zhenshan97 panicle, score: 87.126 N N N N
vg0628725900 G -> DEL N N silent_mutation Average:72.14; most accessible tissue: Zhenshan97 panicle, score: 87.126 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0628725900 NA 7.57E-13 mr1449 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628725900 NA 8.01E-20 mr1627 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628725900 NA 4.91E-07 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628725900 NA 1.01E-07 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628725900 NA 6.55E-06 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628725900 NA 1.35E-09 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628725900 NA 4.00E-06 mr1379_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628725900 NA 6.46E-10 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628725900 NA 3.85E-14 mr1454_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628725900 NA 2.12E-06 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628725900 NA 2.21E-17 mr1578_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628725900 NA 2.56E-06 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628725900 NA 1.13E-07 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628725900 NA 5.27E-09 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628725900 NA 1.28E-09 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628725900 8.82E-08 NA mr1977_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628725900 6.14E-08 1.96E-09 mr1977_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628725900 NA 5.01E-06 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251