Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0628725900:

Variant ID: vg0628725900 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 28725900
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAGTACACCAAAGGTCCCTCAACTTGTCATCAAGTTACAAAATCGTCCCGACCACAAAACTAGATATCGGCCGTCCCTTAACTAATCAAAATCGGTCACA[G/A]
TAGGCCCTTTGGTGGTGTTGACCCCGGTTTTGTCCTACGTGGCGACTGAGTCAGCGTGGGACCCACGAGTCAGGATGCCACGTCATCTATCTCCTTCCTC

Reverse complement sequence

GAGGAAGGAGATAGATGACGTGGCATCCTGACTCGTGGGTCCCACGCTGACTCAGTCGCCACGTAGGACAAAACCGGGGTCAACACCACCAAAGGGCCTA[C/T]
TGTGACCGATTTTGATTAGTTAAGGGACGGCCGATATCTAGTTTTGTGGTCGGGACGATTTTGTAACTTGATGACAAGTTGAGGGACCTTTGGTGTACTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	22.50%	8.80%	5.44%	63.29%	NA
All Indica	2759	1.50%	1.90%	2.54%	94.02%	NA
All Japonica	1512	64.20%	23.50%	8.66%	3.64%	NA
Aus	269	8.60%	0.40%	15.24%	75.84%	NA
Indica I	595	0.70%	7.20%	3.36%	88.74%	NA
Indica II	465	1.50%	0.90%	0.00%	97.63%	NA
Indica III	913	0.90%	0.10%	2.96%	96.06%	NA
Indica Intermediate	786	2.90%	0.60%	2.93%	93.51%	NA
Temperate Japonica	767	41.30%	43.40%	12.65%	2.61%	NA
Tropical Japonica	504	90.50%	2.00%	2.38%	5.16%	NA
Japonica Intermediate	241	82.20%	5.00%	9.13%	3.73%	NA
VI/Aromatic	96	3.10%	0.00%	7.29%	89.58%	NA
Intermediate	90	25.60%	7.80%	8.89%	57.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0628725900	G -> A	LOC_Os06g47390.1	upstream_gene_variant ; 4315.0bp to feature; MODIFIER	silent_mutation	Average:72.14; most accessible tissue: Zhenshan97 panicle, score: 87.126	N	N	N	N
vg0628725900	G -> A	LOC_Os06g47400.1	upstream_gene_variant ; 1544.0bp to feature; MODIFIER	silent_mutation	Average:72.14; most accessible tissue: Zhenshan97 panicle, score: 87.126	N	N	N	N
vg0628725900	G -> A	LOC_Os06g47420.1	downstream_gene_variant ; 745.0bp to feature; MODIFIER	silent_mutation	Average:72.14; most accessible tissue: Zhenshan97 panicle, score: 87.126	N	N	N	N
vg0628725900	G -> A	LOC_Os06g47410.1	intron_variant ; MODIFIER	silent_mutation	Average:72.14; most accessible tissue: Zhenshan97 panicle, score: 87.126	N	N	N	N
vg0628725900	G -> DEL	N	N	silent_mutation	Average:72.14; most accessible tissue: Zhenshan97 panicle, score: 87.126	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0628725900	NA	7.57E-13	mr1449	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628725900	NA	8.01E-20	mr1627	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628725900	NA	4.91E-07	mr1915	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628725900	NA	1.01E-07	mr1010_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628725900	NA	6.55E-06	mr1329_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628725900	NA	1.35E-09	mr1379_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628725900	NA	4.00E-06	mr1379_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628725900	NA	6.46E-10	mr1449_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628725900	NA	3.85E-14	mr1454_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628725900	NA	2.12E-06	mr1524_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628725900	NA	2.21E-17	mr1578_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628725900	NA	2.56E-06	mr1627_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628725900	NA	1.13E-07	mr1683_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628725900	NA	5.27E-09	mr1819_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628725900	NA	1.28E-09	mr1851_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628725900	8.82E-08	NA	mr1977_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628725900	6.14E-08	1.96E-09	mr1977_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628725900	NA	5.01E-06	mr1980_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251