\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0628669362:

Variant ID: vg0628669362 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 28669362
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCGGATGTCCCCTCCCTAAATAGGCATCATTACCCATAACAAATTCACACAACACGGGTCGTGCCATAGACACGAAACGCTAGCCACCACGCCAAGCGCC[C/T]
AACCCCAACTCCAACTCCAACCCGTCGTGCTCACCGAGAAAGGCGAAATTGAAAACCACCCCAACCCGAGAAAATTGCATATCTACCATCGCATAAGATT

Reverse complement sequence

AATCTTATGCGATGGTAGATATGCAATTTTCTCGGGTTGGGGTGGTTTTCAATTTCGCCTTTCTCGGTGAGCACGACGGGTTGGAGTTGGAGTTGGGGTT[G/A]
GGCGCTTGGCGTGGTGGCTAGCGTTTCGTGTCTATGGCACGACCCGTGTTGTGTGAATTTGTTATGGGTAATGATGCCTATTTAGGGAGGGGACATCCGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.00% 40.00% 0.06% 0.00% NA
All Indica  2759 87.00% 13.00% 0.04% 0.00% NA
All Japonica  1512 3.00% 97.00% 0.00% 0.00% NA
Aus  269 90.30% 9.70% 0.00% 0.00% NA
Indica I  595 72.60% 27.40% 0.00% 0.00% NA
Indica II  465 98.30% 1.70% 0.00% 0.00% NA
Indica III  913 90.90% 9.10% 0.00% 0.00% NA
Indica Intermediate  786 86.60% 13.20% 0.13% 0.00% NA
Temperate Japonica  767 3.00% 97.00% 0.00% 0.00% NA
Tropical Japonica  504 2.60% 97.40% 0.00% 0.00% NA
Japonica Intermediate  241 4.10% 95.90% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 61.10% 36.70% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0628669362 C -> T LOC_Os06g47294.1 upstream_gene_variant ; 1507.0bp to feature; MODIFIER silent_mutation Average:62.46; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg0628669362 C -> T LOC_Os06g47300.1 upstream_gene_variant ; 836.0bp to feature; MODIFIER silent_mutation Average:62.46; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg0628669362 C -> T LOC_Os06g47300.2 upstream_gene_variant ; 842.0bp to feature; MODIFIER silent_mutation Average:62.46; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg0628669362 C -> T LOC_Os06g47300.3 upstream_gene_variant ; 842.0bp to feature; MODIFIER silent_mutation Average:62.46; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg0628669362 C -> T LOC_Os06g47294-LOC_Os06g47300 intergenic_region ; MODIFIER silent_mutation Average:62.46; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0628669362 NA 1.49E-39 mr1480 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628669362 NA 2.46E-18 mr1968 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628669362 NA 1.80E-10 mr1232_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628669362 NA 1.47E-17 mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628669362 NA 4.79E-25 mr1653_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628669362 NA 9.39E-08 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628669362 NA 1.60E-07 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628669362 NA 4.42E-13 mr1838_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628669362 NA 2.89E-21 mr1968_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251