\
| Variant ID: vg0628669362 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 28669362 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CCGGATGTCCCCTCCCTAAATAGGCATCATTACCCATAACAAATTCACACAACACGGGTCGTGCCATAGACACGAAACGCTAGCCACCACGCCAAGCGCC[C/T]
AACCCCAACTCCAACTCCAACCCGTCGTGCTCACCGAGAAAGGCGAAATTGAAAACCACCCCAACCCGAGAAAATTGCATATCTACCATCGCATAAGATT
AATCTTATGCGATGGTAGATATGCAATTTTCTCGGGTTGGGGTGGTTTTCAATTTCGCCTTTCTCGGTGAGCACGACGGGTTGGAGTTGGAGTTGGGGTT[G/A]
GGCGCTTGGCGTGGTGGCTAGCGTTTCGTGTCTATGGCACGACCCGTGTTGTGTGAATTTGTTATGGGTAATGATGCCTATTTAGGGAGGGGACATCCGG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.00% | 40.00% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 87.00% | 13.00% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 3.00% | 97.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 90.30% | 9.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 72.60% | 27.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 90.90% | 9.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 86.60% | 13.20% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 3.00% | 97.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 2.60% | 97.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 4.10% | 95.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 61.10% | 36.70% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0628669362 | C -> T | LOC_Os06g47294.1 | upstream_gene_variant ; 1507.0bp to feature; MODIFIER | silent_mutation | Average:62.46; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| vg0628669362 | C -> T | LOC_Os06g47300.1 | upstream_gene_variant ; 836.0bp to feature; MODIFIER | silent_mutation | Average:62.46; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| vg0628669362 | C -> T | LOC_Os06g47300.2 | upstream_gene_variant ; 842.0bp to feature; MODIFIER | silent_mutation | Average:62.46; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| vg0628669362 | C -> T | LOC_Os06g47300.3 | upstream_gene_variant ; 842.0bp to feature; MODIFIER | silent_mutation | Average:62.46; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| vg0628669362 | C -> T | LOC_Os06g47294-LOC_Os06g47300 | intergenic_region ; MODIFIER | silent_mutation | Average:62.46; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0628669362 | NA | 1.49E-39 | mr1480 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628669362 | NA | 2.46E-18 | mr1968 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628669362 | NA | 1.80E-10 | mr1232_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628669362 | NA | 1.47E-17 | mr1557_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628669362 | NA | 4.79E-25 | mr1653_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628669362 | NA | 9.39E-08 | mr1681_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628669362 | NA | 1.60E-07 | mr1824_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628669362 | NA | 4.42E-13 | mr1838_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628669362 | NA | 2.89E-21 | mr1968_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |