\
| Variant ID: vg0628643421 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 28643421 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ATAAATCAAATGATAGGAAAAGAATTAATAATTACTTAAATTTTTTGAATAAGACAAATATTTAAACATTTTTAAAAAAATTAACGGCGTCAAATATTTA[A/G]
GGATAGAGGAAGTAGTAGAAAGGAGCAGTTTAACGATACTGTCACTGTGGGCGCCCACTTTACAGCGGCACGAGCTGCTGGTTCTGCATAGTAAGTCGTA
TACGACTTACTATGCAGAACCAGCAGCTCGTGCCGCTGTAAAGTGGGCGCCCACAGTGACAGTATCGTTAAACTGCTCCTTTCTACTACTTCCTCTATCC[T/C]
TAAATATTTGACGCCGTTAATTTTTTTAAAAATGTTTAAATATTTGTCTTATTCAAAAAATTTAAGTAATTATTAATTCTTTTCCTATCATTTGATTTAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.60% | 6.20% | 2.20% | 0.00% | NA |
| All Indica | 2759 | 99.10% | 0.20% | 0.65% | 0.00% | NA |
| All Japonica | 1512 | 75.80% | 18.70% | 5.56% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.10% | 1.00% | 2.86% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 56.50% | 35.10% | 8.47% | 0.00% | NA |
| Tropical Japonica | 504 | 98.00% | 1.00% | 0.99% | 0.00% | NA |
| Japonica Intermediate | 241 | 90.90% | 3.30% | 5.81% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 6.70% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0628643421 | A -> G | LOC_Os06g47230.1 | upstream_gene_variant ; 2049.0bp to feature; MODIFIER | silent_mutation | Average:51.315; most accessible tissue: Callus, score: 78.667 | N | N | N | N |
| vg0628643421 | A -> G | LOC_Os06g47250.1 | downstream_gene_variant ; 719.0bp to feature; MODIFIER | silent_mutation | Average:51.315; most accessible tissue: Callus, score: 78.667 | N | N | N | N |
| vg0628643421 | A -> G | LOC_Os06g47230-LOC_Os06g47250 | intergenic_region ; MODIFIER | silent_mutation | Average:51.315; most accessible tissue: Callus, score: 78.667 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0628643421 | NA | 5.70E-09 | mr1010_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628643421 | NA | 4.29E-07 | mr1051_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628643421 | NA | 2.63E-07 | mr1446_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628643421 | NA | 3.76E-09 | mr1576_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628643421 | 3.58E-06 | NA | mr1627_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628643421 | NA | 7.96E-10 | mr1627_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628643421 | 1.12E-06 | 8.79E-09 | mr1977_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628643421 | 1.15E-06 | 9.40E-07 | mr1977_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |