Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0628615808:

Variant ID: vg0628615808 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 28615808
Reference Allele: GAlternative Allele: C,T
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGGAAACGATGTGACGGAAAAGTTAAAAGTTTCTGTGTGTAGAAAAGTTTTGATATATGATGAAAAAGTTAGAAGTTCGAAGAAAAACTTTAACTGAACT[G/C,T]
GGCCTTGGAGTCTTTGTCTGGGAACAAAATGTTCAACTGTTCTAGTCAAGATCTGACTATCTGAGAGGTTGCGGGGAGTTCATGCTGTCTCAGTGCTCCA

Reverse complement sequence

TGGAGCACTGAGACAGCATGAACTCCCCGCAACCTCTCAGATAGTCAGATCTTGACTAGAACAGTTGAACATTTTGTTCCCAGACAAAGACTCCAAGGCC[C/G,A]
AGTTCAGTTAAAGTTTTTCTTCGAACTTCTAACTTTTTCATCATATATCAAAACTTTTCTACACACAGAAACTTTTAACTTTTCCGTCACATCGTTTCCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.00% 33.00% 0.00% 0.00% T: 0.02%
All Indica  2759 97.10% 2.90% 0.00% 0.00% NA
All Japonica  1512 4.80% 95.20% 0.00% 0.00% NA
Aus  269 95.50% 4.10% 0.00% 0.00% T: 0.37%
Indica I  595 91.40% 8.60% 0.00% 0.00% NA
Indica II  465 98.90% 1.10% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 97.20% 2.80% 0.00% 0.00% NA
Temperate Japonica  767 3.00% 97.00% 0.00% 0.00% NA
Tropical Japonica  504 7.90% 92.10% 0.00% 0.00% NA
Japonica Intermediate  241 4.10% 95.90% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 66.70% 33.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0628615808 G -> C LOC_Os06g47180.1 upstream_gene_variant ; 4728.0bp to feature; MODIFIER silent_mutation Average:78.114; most accessible tissue: Zhenshan97 root, score: 91.073 N N N N
vg0628615808 G -> C LOC_Os06g47190.1 upstream_gene_variant ; 2848.0bp to feature; MODIFIER silent_mutation Average:78.114; most accessible tissue: Zhenshan97 root, score: 91.073 N N N N
vg0628615808 G -> C LOC_Os06g47200.1 upstream_gene_variant ; 1639.0bp to feature; MODIFIER silent_mutation Average:78.114; most accessible tissue: Zhenshan97 root, score: 91.073 N N N N
vg0628615808 G -> C LOC_Os06g47200.3 upstream_gene_variant ; 1639.0bp to feature; MODIFIER silent_mutation Average:78.114; most accessible tissue: Zhenshan97 root, score: 91.073 N N N N
vg0628615808 G -> C LOC_Os06g47200.2 upstream_gene_variant ; 1639.0bp to feature; MODIFIER silent_mutation Average:78.114; most accessible tissue: Zhenshan97 root, score: 91.073 N N N N
vg0628615808 G -> C LOC_Os06g47190-LOC_Os06g47200 intergenic_region ; MODIFIER silent_mutation Average:78.114; most accessible tissue: Zhenshan97 root, score: 91.073 N N N N
vg0628615808 G -> T LOC_Os06g47180.1 upstream_gene_variant ; 4728.0bp to feature; MODIFIER silent_mutation Average:78.114; most accessible tissue: Zhenshan97 root, score: 91.073 N N N N
vg0628615808 G -> T LOC_Os06g47190.1 upstream_gene_variant ; 2848.0bp to feature; MODIFIER silent_mutation Average:78.114; most accessible tissue: Zhenshan97 root, score: 91.073 N N N N
vg0628615808 G -> T LOC_Os06g47200.1 upstream_gene_variant ; 1639.0bp to feature; MODIFIER silent_mutation Average:78.114; most accessible tissue: Zhenshan97 root, score: 91.073 N N N N
vg0628615808 G -> T LOC_Os06g47200.3 upstream_gene_variant ; 1639.0bp to feature; MODIFIER silent_mutation Average:78.114; most accessible tissue: Zhenshan97 root, score: 91.073 N N N N
vg0628615808 G -> T LOC_Os06g47200.2 upstream_gene_variant ; 1639.0bp to feature; MODIFIER silent_mutation Average:78.114; most accessible tissue: Zhenshan97 root, score: 91.073 N N N N
vg0628615808 G -> T LOC_Os06g47190-LOC_Os06g47200 intergenic_region ; MODIFIER silent_mutation Average:78.114; most accessible tissue: Zhenshan97 root, score: 91.073 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0628615808 G C 0.07 -0.03 -0.03 -0.06 -0.05 -0.06
vg0628615808 G T 0.05 0.01 0.0 -0.08 -0.05 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0628615808 NA 3.70E-36 mr1105 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628615808 NA 2.83E-44 mr1136 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628615808 NA 8.32E-11 mr1172 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628615808 NA 5.78E-46 mr1194 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628615808 NA 3.22E-31 mr1243 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628615808 NA 2.45E-47 mr1480 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628615808 NA 3.04E-19 mr1627 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628615808 NA 9.78E-58 mr1692 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628615808 NA 4.69E-19 mr1715 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628615808 NA 5.33E-20 mr1838 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628615808 NA 2.05E-21 mr1839 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628615808 NA 9.00E-34 mr1932 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628615808 NA 1.90E-18 mr1968 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628615808 NA 2.27E-33 mr1105_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628615808 NA 1.06E-18 mr1168_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628615808 NA 3.52E-52 mr1194_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628615808 NA 1.11E-09 mr1232_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628615808 NA 1.25E-57 mr1480_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628615808 NA 3.79E-18 mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628615808 NA 7.88E-25 mr1653_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628615808 NA 1.33E-07 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628615808 NA 3.60E-12 mr1714_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628615808 NA 1.73E-15 mr1767_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628615808 NA 2.62E-10 mr1806_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628615808 NA 6.11E-64 mr1896_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628615808 NA 1.71E-40 mr1944_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628615808 NA 9.00E-25 mr1968_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628615808 NA 9.73E-11 mr1986_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251