\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0628585588:

Variant ID: vg0628585588 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 28585588
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTGGACCGCAGGAAAAACGCAGAAATTAGAGGAGAGATAAAGACTCAAAGGAAAGTTTCCAAGAGGTTTTAGAATTCCTCCAAAACTTATATGGCATTAG[A/G]
CAATCCATAAGATTTTCATAGGATTTCATAAGATCCATTCCTTTGATTTGAAGGGCTATATAGAAAAAATTTCTATAAAAATAAATTTCTCCAAAACTTC

Reverse complement sequence

GAAGTTTTGGAGAAATTTATTTTTATAGAAATTTTTTCTATATAGCCCTTCAAATCAAAGGAATGGATCTTATGAAATCCTATGAAAATCTTATGGATTG[T/C]
CTAATGCCATATAAGTTTTGGAGGAATTCTAAAACCTCTTGGAAACTTTCCTTTGAGTCTTTATCTCTCCTCTAATTTCTGCGTTTTTCCTGCGGTCCAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.00% 33.00% 0.40% 0.66% NA
All Indica  2759 95.70% 2.80% 0.47% 1.05% NA
All Japonica  1512 4.80% 95.10% 0.00% 0.13% NA
Aus  269 94.40% 4.50% 1.12% 0.00% NA
Indica I  595 89.70% 8.90% 0.17% 1.18% NA
Indica II  465 97.00% 1.10% 0.43% 1.51% NA
Indica III  913 97.90% 0.10% 0.88% 1.10% NA
Indica Intermediate  786 96.70% 2.40% 0.25% 0.64% NA
Temperate Japonica  767 2.70% 97.00% 0.00% 0.26% NA
Tropical Japonica  504 7.90% 92.10% 0.00% 0.00% NA
Japonica Intermediate  241 4.60% 95.40% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 2.10% 3.12% 0.00% NA
Intermediate  90 67.80% 32.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0628585588 A -> G LOC_Os06g47150.1 upstream_gene_variant ; 857.0bp to feature; MODIFIER silent_mutation Average:72.646; most accessible tissue: Minghui63 panicle, score: 91.586 N N N N
vg0628585588 A -> G LOC_Os06g47150.3 upstream_gene_variant ; 877.0bp to feature; MODIFIER silent_mutation Average:72.646; most accessible tissue: Minghui63 panicle, score: 91.586 N N N N
vg0628585588 A -> G LOC_Os06g47150.2 upstream_gene_variant ; 897.0bp to feature; MODIFIER silent_mutation Average:72.646; most accessible tissue: Minghui63 panicle, score: 91.586 N N N N
vg0628585588 A -> G LOC_Os06g47150.4 upstream_gene_variant ; 897.0bp to feature; MODIFIER silent_mutation Average:72.646; most accessible tissue: Minghui63 panicle, score: 91.586 N N N N
vg0628585588 A -> G LOC_Os06g47140-LOC_Os06g47150 intergenic_region ; MODIFIER silent_mutation Average:72.646; most accessible tissue: Minghui63 panicle, score: 91.586 N N N N
vg0628585588 A -> DEL N N silent_mutation Average:72.646; most accessible tissue: Minghui63 panicle, score: 91.586 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0628585588 NA 3.65E-35 mr1105 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628585588 NA 5.23E-47 mr1136 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628585588 NA 6.72E-45 mr1194 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628585588 NA 4.04E-31 mr1243 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628585588 NA 3.99E-46 mr1480 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628585588 NA 1.66E-19 mr1627 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628585588 NA 1.65E-72 mr1629 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628585588 NA 3.99E-57 mr1692 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628585588 NA 3.62E-19 mr1715 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628585588 NA 4.55E-22 mr1839 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628585588 NA 1.06E-34 mr1932 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628585588 NA 1.22E-18 mr1968 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628585588 NA 4.69E-34 mr1105_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628585588 NA 1.73E-52 mr1194_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628585588 NA 9.89E-10 mr1232_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628585588 NA 9.25E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628585588 NA 2.09E-18 mr1383_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628585588 NA 1.27E-58 mr1480_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628585588 NA 5.76E-19 mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628585588 NA 8.90E-12 mr1636_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628585588 NA 5.83E-12 mr1641_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628585588 NA 5.38E-26 mr1653_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628585588 NA 1.32E-07 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628585588 NA 2.16E-81 mr1711_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628585588 NA 1.17E-12 mr1714_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628585588 NA 3.72E-16 mr1715_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628585588 NA 3.19E-16 mr1767_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628585588 NA 1.61E-10 mr1806_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628585588 NA 2.45E-13 mr1838_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628585588 NA 3.14E-41 mr1944_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628585588 NA 7.16E-26 mr1968_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628585588 NA 6.19E-11 mr1986_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628585588 NA 2.59E-51 mr1991_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251