Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0628585506:

Variant ID: vg0628585506 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 28585506
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.01, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:

AAAAACGTAGAATTTTGATAGGAATGTAAGTGTAAAACAGAGGATTACAAAACACAGGAAAAATATAGGAATGGTCGTTTGATTGGACCGCAGGAAAAAC[G/A]
CAGAAATTAGAGGAGAGATAAAGACTCAAAGGAAAGTTTCCAAGAGGTTTTAGAATTCCTCCAAAACTTATATGGCATTAGACAATCCATAAGATTTTCA

Reverse complement sequence

TGAAAATCTTATGGATTGTCTAATGCCATATAAGTTTTGGAGGAATTCTAAAACCTCTTGGAAACTTTCCTTTGAGTCTTTATCTCTCCTCTAATTTCTG[C/T]
GTTTTTCCTGCGGTCCAATCAAACGACCATTCCTATATTTTTCCTGTGTTTTGTAATCCTCTGTTTTACACTTACATTCCTATCAAAATTCTACGTTTTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.20%	45.20%	0.44%	0.13%	NA
All Indica	2759	85.20%	14.10%	0.43%	0.22%	NA
All Japonica	1512	4.20%	95.20%	0.60%	0.00%	NA
Aus	269	26.80%	73.20%	0.00%	0.00%	NA
Indica I	595	82.50%	17.10%	0.34%	0.00%	NA
Indica II	465	96.10%	3.40%	0.22%	0.22%	NA
Indica III	913	86.50%	12.60%	0.55%	0.33%	NA
Indica Intermediate	786	79.40%	19.80%	0.51%	0.25%	NA
Temperate Japonica	767	2.70%	96.10%	1.17%	0.00%	NA
Tropical Japonica	504	7.30%	92.70%	0.00%	0.00%	NA
Japonica Intermediate	241	2.10%	97.90%	0.00%	0.00%	NA
VI/Aromatic	96	29.20%	70.80%	0.00%	0.00%	NA
Intermediate	90	52.20%	47.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0628585506	G -> A	LOC_Os06g47150.1	upstream_gene_variant ; 939.0bp to feature; MODIFIER	silent_mutation	Average:51.957; most accessible tissue: Minghui63 panicle, score: 84.552	N	N	N	N
vg0628585506	G -> A	LOC_Os06g47150.3	upstream_gene_variant ; 959.0bp to feature; MODIFIER	silent_mutation	Average:51.957; most accessible tissue: Minghui63 panicle, score: 84.552	N	N	N	N
vg0628585506	G -> A	LOC_Os06g47150.2	upstream_gene_variant ; 979.0bp to feature; MODIFIER	silent_mutation	Average:51.957; most accessible tissue: Minghui63 panicle, score: 84.552	N	N	N	N
vg0628585506	G -> A	LOC_Os06g47150.4	upstream_gene_variant ; 979.0bp to feature; MODIFIER	silent_mutation	Average:51.957; most accessible tissue: Minghui63 panicle, score: 84.552	N	N	N	N
vg0628585506	G -> A	LOC_Os06g47140-LOC_Os06g47150	intergenic_region ; MODIFIER	silent_mutation	Average:51.957; most accessible tissue: Minghui63 panicle, score: 84.552	N	N	N	N
vg0628585506	G -> DEL	N	N	silent_mutation	Average:51.957; most accessible tissue: Minghui63 panicle, score: 84.552	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0628585506	NA	2.38E-11	mr1138	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628585506	NA	8.85E-06	mr1138	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628585506	NA	2.46E-07	mr1756	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628585506	NA	1.53E-11	mr1138_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628585506	NA	2.07E-06	mr1860_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628585506	NA	5.79E-06	mr1974_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628585506	NA	5.91E-06	mr1980_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251