\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0628585506:

Variant ID: vg0628585506 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 28585506
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.01, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


AAAAACGTAGAATTTTGATAGGAATGTAAGTGTAAAACAGAGGATTACAAAACACAGGAAAAATATAGGAATGGTCGTTTGATTGGACCGCAGGAAAAAC[G/A]
CAGAAATTAGAGGAGAGATAAAGACTCAAAGGAAAGTTTCCAAGAGGTTTTAGAATTCCTCCAAAACTTATATGGCATTAGACAATCCATAAGATTTTCA

Reverse complement sequence

TGAAAATCTTATGGATTGTCTAATGCCATATAAGTTTTGGAGGAATTCTAAAACCTCTTGGAAACTTTCCTTTGAGTCTTTATCTCTCCTCTAATTTCTG[C/T]
GTTTTTCCTGCGGTCCAATCAAACGACCATTCCTATATTTTTCCTGTGTTTTGTAATCCTCTGTTTTACACTTACATTCCTATCAAAATTCTACGTTTTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.20% 45.20% 0.44% 0.13% NA
All Indica  2759 85.20% 14.10% 0.43% 0.22% NA
All Japonica  1512 4.20% 95.20% 0.60% 0.00% NA
Aus  269 26.80% 73.20% 0.00% 0.00% NA
Indica I  595 82.50% 17.10% 0.34% 0.00% NA
Indica II  465 96.10% 3.40% 0.22% 0.22% NA
Indica III  913 86.50% 12.60% 0.55% 0.33% NA
Indica Intermediate  786 79.40% 19.80% 0.51% 0.25% NA
Temperate Japonica  767 2.70% 96.10% 1.17% 0.00% NA
Tropical Japonica  504 7.30% 92.70% 0.00% 0.00% NA
Japonica Intermediate  241 2.10% 97.90% 0.00% 0.00% NA
VI/Aromatic  96 29.20% 70.80% 0.00% 0.00% NA
Intermediate  90 52.20% 47.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0628585506 G -> A LOC_Os06g47150.1 upstream_gene_variant ; 939.0bp to feature; MODIFIER silent_mutation Average:51.957; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N
vg0628585506 G -> A LOC_Os06g47150.3 upstream_gene_variant ; 959.0bp to feature; MODIFIER silent_mutation Average:51.957; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N
vg0628585506 G -> A LOC_Os06g47150.2 upstream_gene_variant ; 979.0bp to feature; MODIFIER silent_mutation Average:51.957; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N
vg0628585506 G -> A LOC_Os06g47150.4 upstream_gene_variant ; 979.0bp to feature; MODIFIER silent_mutation Average:51.957; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N
vg0628585506 G -> A LOC_Os06g47140-LOC_Os06g47150 intergenic_region ; MODIFIER silent_mutation Average:51.957; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N
vg0628585506 G -> DEL N N silent_mutation Average:51.957; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0628585506 NA 2.38E-11 mr1138 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628585506 NA 8.85E-06 mr1138 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628585506 NA 2.46E-07 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628585506 NA 1.53E-11 mr1138_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628585506 NA 2.07E-06 mr1860_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628585506 NA 5.79E-06 mr1974_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628585506 NA 5.91E-06 mr1980_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251