Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0628556574:

Variant ID: vg0628556574 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 28556574
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 304. )

Flanking Sequence (100 bp) in Reference Genome:

TGAATGGTATTACCCGCCACAGTTACAGCCTGAAAATCAGAAGTAGCAAACAACCTTGTGAATCAAGTGGAAACAACACGATTGAGATGAAAATGAAATC[A/G]
GATGAAATTAACATGATCGAGAGAAAAAAAAAGAACGAACCCGGAGAGAAGTGCTGCACAGGGTGAGGAAGGTGAGGTTCGAGAGATCTGGGAGGCGTTT

Reverse complement sequence

AAACGCCTCCCAGATCTCTCGAACCTCACCTTCCTCACCCTGTGCAGCACTTCTCTCCGGGTTCGTTCTTTTTTTTTCTCTCGATCATGTTAATTTCATC[T/C]
GATTTCATTTTCATCTCAATCGTGTTGTTTCCACTTGATTCACAAGGTTGTTTGCTACTTCTGATTTTCAGGCTGTAACTGTGGCGGGTAATACCATTCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.10%	32.90%	0.02%	0.04%	NA
All Indica	2759	97.10%	2.80%	0.00%	0.07%	NA
All Japonica	1512	5.00%	95.00%	0.00%	0.00%	NA
Aus	269	97.00%	3.00%	0.00%	0.00%	NA
Indica I	595	91.80%	8.10%	0.00%	0.17%	NA
Indica II	465	98.90%	1.10%	0.00%	0.00%	NA
Indica III	913	99.30%	0.50%	0.00%	0.11%	NA
Indica Intermediate	786	97.50%	2.50%	0.00%	0.00%	NA
Temperate Japonica	767	3.30%	96.70%	0.00%	0.00%	NA
Tropical Japonica	504	7.70%	92.30%	0.00%	0.00%	NA
Japonica Intermediate	241	4.60%	95.40%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	67.80%	31.10%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0628556574	A -> G	LOC_Os06g47130.1	upstream_gene_variant ; 1718.0bp to feature; MODIFIER	silent_mutation	Average:56.649; most accessible tissue: Callus, score: 84.499	N	N	N	N
vg0628556574	A -> G	LOC_Os06g47130.3	upstream_gene_variant ; 1718.0bp to feature; MODIFIER	silent_mutation	Average:56.649; most accessible tissue: Callus, score: 84.499	N	N	N	N
vg0628556574	A -> G	LOC_Os06g47130.2	upstream_gene_variant ; 1718.0bp to feature; MODIFIER	silent_mutation	Average:56.649; most accessible tissue: Callus, score: 84.499	N	N	N	N
vg0628556574	A -> G	LOC_Os06g47110.1	downstream_gene_variant ; 2497.0bp to feature; MODIFIER	silent_mutation	Average:56.649; most accessible tissue: Callus, score: 84.499	N	N	N	N
vg0628556574	A -> G	LOC_Os06g47120.1	intron_variant ; MODIFIER	silent_mutation	Average:56.649; most accessible tissue: Callus, score: 84.499	N	N	N	N
vg0628556574	A -> DEL	N	N	silent_mutation	Average:56.649; most accessible tissue: Callus, score: 84.499	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0628556574	NA	1.29E-36	mr1105	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628556574	NA	5.59E-45	mr1136	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628556574	NA	6.63E-11	mr1172	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628556574	NA	9.78E-45	mr1194	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628556574	NA	6.44E-47	mr1480	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628556574	NA	2.73E-17	mr1557	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628556574	NA	1.25E-19	mr1627	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628556574	NA	6.58E-28	mr1638	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628556574	NA	9.61E-14	mr1653	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628556574	NA	3.21E-58	mr1692	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628556574	NA	1.14E-18	mr1715	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628556574	NA	1.75E-20	mr1838	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628556574	NA	1.23E-33	mr1932	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628556574	NA	6.45E-19	mr1968	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628556574	NA	7.70E-34	mr1105_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628556574	NA	3.45E-20	mr1168_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628556574	NA	1.10E-09	mr1232_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628556574	NA	1.67E-06	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628556574	NA	2.26E-19	mr1383_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628556574	NA	3.99E-56	mr1480_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628556574	NA	3.70E-14	mr1529_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628556574	NA	2.02E-18	mr1557_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628556574	NA	4.74E-12	mr1641_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628556574	NA	5.66E-25	mr1653_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628556574	NA	3.01E-12	mr1714_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628556574	NA	1.30E-15	mr1767_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628556574	NA	4.78E-10	mr1806_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628556574	NA	1.63E-40	mr1944_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628556574	NA	1.48E-24	mr1968_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251