\
| Variant ID: vg0628556574 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 28556574 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 304. )
TGAATGGTATTACCCGCCACAGTTACAGCCTGAAAATCAGAAGTAGCAAACAACCTTGTGAATCAAGTGGAAACAACACGATTGAGATGAAAATGAAATC[A/G]
GATGAAATTAACATGATCGAGAGAAAAAAAAAGAACGAACCCGGAGAGAAGTGCTGCACAGGGTGAGGAAGGTGAGGTTCGAGAGATCTGGGAGGCGTTT
AAACGCCTCCCAGATCTCTCGAACCTCACCTTCCTCACCCTGTGCAGCACTTCTCTCCGGGTTCGTTCTTTTTTTTTCTCTCGATCATGTTAATTTCATC[T/C]
GATTTCATTTTCATCTCAATCGTGTTGTTTCCACTTGATTCACAAGGTTGTTTGCTACTTCTGATTTTCAGGCTGTAACTGTGGCGGGTAATACCATTCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.10% | 32.90% | 0.02% | 0.04% | NA |
| All Indica | 2759 | 97.10% | 2.80% | 0.00% | 0.07% | NA |
| All Japonica | 1512 | 5.00% | 95.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 91.80% | 8.10% | 0.00% | 0.17% | NA |
| Indica II | 465 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.30% | 0.50% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 3.30% | 96.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 7.70% | 92.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 4.60% | 95.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 67.80% | 31.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0628556574 | A -> G | LOC_Os06g47130.1 | upstream_gene_variant ; 1718.0bp to feature; MODIFIER | silent_mutation | Average:56.649; most accessible tissue: Callus, score: 84.499 | N | N | N | N |
| vg0628556574 | A -> G | LOC_Os06g47130.3 | upstream_gene_variant ; 1718.0bp to feature; MODIFIER | silent_mutation | Average:56.649; most accessible tissue: Callus, score: 84.499 | N | N | N | N |
| vg0628556574 | A -> G | LOC_Os06g47130.2 | upstream_gene_variant ; 1718.0bp to feature; MODIFIER | silent_mutation | Average:56.649; most accessible tissue: Callus, score: 84.499 | N | N | N | N |
| vg0628556574 | A -> G | LOC_Os06g47110.1 | downstream_gene_variant ; 2497.0bp to feature; MODIFIER | silent_mutation | Average:56.649; most accessible tissue: Callus, score: 84.499 | N | N | N | N |
| vg0628556574 | A -> G | LOC_Os06g47120.1 | intron_variant ; MODIFIER | silent_mutation | Average:56.649; most accessible tissue: Callus, score: 84.499 | N | N | N | N |
| vg0628556574 | A -> DEL | N | N | silent_mutation | Average:56.649; most accessible tissue: Callus, score: 84.499 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0628556574 | NA | 1.29E-36 | mr1105 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628556574 | NA | 5.59E-45 | mr1136 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628556574 | NA | 6.63E-11 | mr1172 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628556574 | NA | 9.78E-45 | mr1194 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628556574 | NA | 6.44E-47 | mr1480 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628556574 | NA | 2.73E-17 | mr1557 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628556574 | NA | 1.25E-19 | mr1627 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628556574 | NA | 6.58E-28 | mr1638 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628556574 | NA | 9.61E-14 | mr1653 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628556574 | NA | 3.21E-58 | mr1692 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628556574 | NA | 1.14E-18 | mr1715 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628556574 | NA | 1.75E-20 | mr1838 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628556574 | NA | 1.23E-33 | mr1932 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628556574 | NA | 6.45E-19 | mr1968 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628556574 | NA | 7.70E-34 | mr1105_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628556574 | NA | 3.45E-20 | mr1168_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628556574 | NA | 1.10E-09 | mr1232_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628556574 | NA | 1.67E-06 | mr1275_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628556574 | NA | 2.26E-19 | mr1383_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628556574 | NA | 3.99E-56 | mr1480_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628556574 | NA | 3.70E-14 | mr1529_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628556574 | NA | 2.02E-18 | mr1557_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628556574 | NA | 4.74E-12 | mr1641_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628556574 | NA | 5.66E-25 | mr1653_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628556574 | NA | 3.01E-12 | mr1714_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628556574 | NA | 1.30E-15 | mr1767_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628556574 | NA | 4.78E-10 | mr1806_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628556574 | NA | 1.63E-40 | mr1944_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628556574 | NA | 1.48E-24 | mr1968_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |