\
| Variant ID: vg0628529241 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 28529241 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CGTTATCCCTAGCATCTCCGAGCTAAACGGAACAAGGCAATACATCGCACTCAATGTATTCAAGGTTAGCTAATTAACTTGCATAATTGTTACTCCCTCT[A/G]
TTTTATATTGTAAGAATTTCTATCATTACTTATATTTTTATCTATTATAAAAGTTTAAGATATTTTTACCCATGATTTTCGTACGTCGTCTGATTCATCC
GGATGAATCAGACGACGTACGAAAATCATGGGTAAAAATATCTTAAACTTTTATAATAGATAAAAATATAAGTAATGATAGAAATTCTTACAATATAAAA[T/C]
AGAGGGAGTAACAATTATGCAAGTTAATTAGCTAACCTTGAATACATTGAGTGCGATGTATTGCCTTGTTCCGTTTAGCTCGGAGATGCTAGGGATAACG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.10% | 34.30% | 0.06% | 5.63% | NA |
| All Indica | 2759 | 94.90% | 3.00% | 0.04% | 2.07% | NA |
| All Japonica | 1512 | 4.60% | 95.20% | 0.07% | 0.07% | NA |
| Aus | 269 | 23.80% | 3.30% | 0.00% | 72.86% | NA |
| Indica I | 595 | 91.80% | 8.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.60% | 1.10% | 0.00% | 1.29% | NA |
| Indica III | 913 | 95.40% | 0.50% | 0.00% | 4.05% | NA |
| Indica Intermediate | 786 | 95.20% | 2.90% | 0.13% | 1.78% | NA |
| Temperate Japonica | 767 | 3.30% | 96.60% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 7.70% | 92.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.50% | 97.10% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 31.20% | 62.50% | 0.00% | 6.25% | NA |
| Intermediate | 90 | 61.10% | 31.10% | 1.11% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0628529241 | A -> G | LOC_Os06g47040.1 | downstream_gene_variant ; 3413.0bp to feature; MODIFIER | silent_mutation | Average:71.678; most accessible tissue: Minghui63 root, score: 84.323 | N | N | N | N |
| vg0628529241 | A -> G | LOC_Os06g47050.1 | downstream_gene_variant ; 28.0bp to feature; MODIFIER | silent_mutation | Average:71.678; most accessible tissue: Minghui63 root, score: 84.323 | N | N | N | N |
| vg0628529241 | A -> G | LOC_Os06g47060.1 | downstream_gene_variant ; 2369.0bp to feature; MODIFIER | silent_mutation | Average:71.678; most accessible tissue: Minghui63 root, score: 84.323 | N | N | N | N |
| vg0628529241 | A -> G | LOC_Os06g47050-LOC_Os06g47060 | intergenic_region ; MODIFIER | silent_mutation | Average:71.678; most accessible tissue: Minghui63 root, score: 84.323 | N | N | N | N |
| vg0628529241 | A -> DEL | N | N | silent_mutation | Average:71.678; most accessible tissue: Minghui63 root, score: 84.323 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0628529241 | NA | 4.53E-10 | mr1175 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628529241 | NA | 1.12E-25 | mr1251 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628529241 | NA | 1.36E-18 | mr1253 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628529241 | NA | 8.45E-37 | mr1435 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628529241 | NA | 2.11E-49 | mr1599 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628529241 | NA | 2.75E-07 | mr1804 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628529241 | NA | 2.63E-40 | mr1828 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628529241 | NA | 1.17E-17 | mr1913 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628529241 | NA | 9.07E-06 | mr1405_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628529241 | NA | 5.84E-12 | mr1714_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628529241 | NA | 1.48E-08 | mr1751_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628529241 | NA | 9.66E-42 | mr1944_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628529241 | NA | 1.27E-20 | mr1968_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |