\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0628529241:

Variant ID: vg0628529241 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 28529241
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGTTATCCCTAGCATCTCCGAGCTAAACGGAACAAGGCAATACATCGCACTCAATGTATTCAAGGTTAGCTAATTAACTTGCATAATTGTTACTCCCTCT[A/G]
TTTTATATTGTAAGAATTTCTATCATTACTTATATTTTTATCTATTATAAAAGTTTAAGATATTTTTACCCATGATTTTCGTACGTCGTCTGATTCATCC

Reverse complement sequence

GGATGAATCAGACGACGTACGAAAATCATGGGTAAAAATATCTTAAACTTTTATAATAGATAAAAATATAAGTAATGATAGAAATTCTTACAATATAAAA[T/C]
AGAGGGAGTAACAATTATGCAAGTTAATTAGCTAACCTTGAATACATTGAGTGCGATGTATTGCCTTGTTCCGTTTAGCTCGGAGATGCTAGGGATAACG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.10% 34.30% 0.06% 5.63% NA
All Indica  2759 94.90% 3.00% 0.04% 2.07% NA
All Japonica  1512 4.60% 95.20% 0.07% 0.07% NA
Aus  269 23.80% 3.30% 0.00% 72.86% NA
Indica I  595 91.80% 8.20% 0.00% 0.00% NA
Indica II  465 97.60% 1.10% 0.00% 1.29% NA
Indica III  913 95.40% 0.50% 0.00% 4.05% NA
Indica Intermediate  786 95.20% 2.90% 0.13% 1.78% NA
Temperate Japonica  767 3.30% 96.60% 0.13% 0.00% NA
Tropical Japonica  504 7.70% 92.30% 0.00% 0.00% NA
Japonica Intermediate  241 2.50% 97.10% 0.00% 0.41% NA
VI/Aromatic  96 31.20% 62.50% 0.00% 6.25% NA
Intermediate  90 61.10% 31.10% 1.11% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0628529241 A -> G LOC_Os06g47040.1 downstream_gene_variant ; 3413.0bp to feature; MODIFIER silent_mutation Average:71.678; most accessible tissue: Minghui63 root, score: 84.323 N N N N
vg0628529241 A -> G LOC_Os06g47050.1 downstream_gene_variant ; 28.0bp to feature; MODIFIER silent_mutation Average:71.678; most accessible tissue: Minghui63 root, score: 84.323 N N N N
vg0628529241 A -> G LOC_Os06g47060.1 downstream_gene_variant ; 2369.0bp to feature; MODIFIER silent_mutation Average:71.678; most accessible tissue: Minghui63 root, score: 84.323 N N N N
vg0628529241 A -> G LOC_Os06g47050-LOC_Os06g47060 intergenic_region ; MODIFIER silent_mutation Average:71.678; most accessible tissue: Minghui63 root, score: 84.323 N N N N
vg0628529241 A -> DEL N N silent_mutation Average:71.678; most accessible tissue: Minghui63 root, score: 84.323 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0628529241 NA 4.53E-10 mr1175 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628529241 NA 1.12E-25 mr1251 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628529241 NA 1.36E-18 mr1253 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628529241 NA 8.45E-37 mr1435 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628529241 NA 2.11E-49 mr1599 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628529241 NA 2.75E-07 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628529241 NA 2.63E-40 mr1828 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628529241 NA 1.17E-17 mr1913 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628529241 NA 9.07E-06 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628529241 NA 5.84E-12 mr1714_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628529241 NA 1.48E-08 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628529241 NA 9.66E-42 mr1944_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628529241 NA 1.27E-20 mr1968_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251