Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0628528239:

Variant ID: vg0628528239 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 28528239
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.64, T: 0.36, others allele: 0.00, population size: 77. )

Flanking Sequence (100 bp) in Reference Genome:

TTCGGTTACGCGGAGTGGAGATCGTGCGGGCGCCCTGATCAAGCGACCTATCTCTATATAAACCGAGCCGCCACCTTCACGCAAAATACACGAAATCAAT[C/T]
TAGGGTTTGCCTCCTCCTCTGTGTTGCGCCGTCGCTCGTGGACTACTCCATCCCACTCGCTAGCGTGCACCGGTGATCGGGAGAGCAGGTCTCCGGAACC

Reverse complement sequence

GGTTCCGGAGACCTGCTCTCCCGATCACCGGTGCACGCTAGCGAGTGGGATGGAGTAGTCCACGAGCGACGGCGCAACACAGAGGAGGAGGCAAACCCTA[G/A]
ATTGATTTCGTGTATTTTGCGTGAAGGTGGCGGCTCGGTTTATATAGAGATAGGTCGCTTGATCAGGGCGCCCGCACGATCTCCACTCCGCGTAACCGAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.40%	33.00%	0.02%	5.59%	NA
All Indica	2759	95.10%	2.90%	0.00%	2.07%	NA
All Japonica	1512	4.80%	95.10%	0.00%	0.07%	NA
Aus	269	24.20%	3.70%	0.00%	72.12%	NA
Indica I	595	91.60%	8.40%	0.00%	0.00%	NA
Indica II	465	97.60%	1.10%	0.00%	1.29%	NA
Indica III	913	95.40%	0.50%	0.00%	4.05%	NA
Indica Intermediate	786	95.80%	2.40%	0.00%	1.78%	NA
Temperate Japonica	767	3.30%	96.70%	0.00%	0.00%	NA
Tropical Japonica	504	7.50%	92.50%	0.00%	0.00%	NA
Japonica Intermediate	241	4.10%	95.40%	0.00%	0.41%	NA
VI/Aromatic	96	91.70%	2.10%	0.00%	6.25%	NA
Intermediate	90	57.80%	34.40%	1.11%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0628528239	C -> T	LOC_Os06g47030.1	downstream_gene_variant ; 4024.0bp to feature; MODIFIER	silent_mutation	Average:50.124; most accessible tissue: Zhenshan97 panicle, score: 76.605	N	N	N	N
vg0628528239	C -> T	LOC_Os06g47040.1	downstream_gene_variant ; 2411.0bp to feature; MODIFIER	silent_mutation	Average:50.124; most accessible tissue: Zhenshan97 panicle, score: 76.605	N	N	N	N
vg0628528239	C -> T	LOC_Os06g47060.1	downstream_gene_variant ; 3371.0bp to feature; MODIFIER	silent_mutation	Average:50.124; most accessible tissue: Zhenshan97 panicle, score: 76.605	N	N	N	N
vg0628528239	C -> T	LOC_Os06g47050.1	intron_variant ; MODIFIER	silent_mutation	Average:50.124; most accessible tissue: Zhenshan97 panicle, score: 76.605	N	N	N	N
vg0628528239	C -> DEL	N	N	silent_mutation	Average:50.124; most accessible tissue: Zhenshan97 panicle, score: 76.605	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0628528239	NA	1.51E-24	mr1251	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628528239	NA	1.78E-19	mr1253	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628528239	NA	4.28E-08	mr1610	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628528239	NA	1.22E-28	mr1638	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628528239	NA	3.25E-37	mr1828	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628528239	NA	2.43E-17	mr1913	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628528239	NA	2.22E-06	mr1105_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628528239	NA	1.35E-13	mr1151_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628528239	NA	1.15E-08	mr1198_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628528239	NA	8.10E-07	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628528239	NA	1.96E-06	mr1289_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628528239	2.60E-06	2.60E-06	mr1307_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628528239	NA	5.77E-10	mr1349_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628528239	NA	9.08E-07	mr1363_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628528239	NA	5.60E-07	mr1405_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628528239	NA	7.61E-06	mr1407_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628528239	NA	1.02E-06	mr1418_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628528239	NA	3.91E-10	mr1506_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628528239	NA	3.28E-12	mr1666_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628528239	NA	2.37E-07	mr1668_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628528239	NA	6.46E-12	mr1714_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628528239	NA	8.29E-10	mr1751_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628528239	NA	1.11E-09	mr1761_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628528239	NA	1.99E-07	mr1824_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628528239	NA	9.24E-06	mr1869_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251