Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0628393090:

Variant ID: vg0628393090 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 28393090
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.67, G: 0.33, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:

GATACACATTTTACATGCACAATAGCTTGATCTACCTGAATTCCTTTGTGCCCTCCAGTAACATCCTAAATTTACTCAAAATCATCCAAGCAAGCTACTT[G/A]
CATGAGTATGGACTGAAGAAGAAAATGAAGTGCCGGAGCAAGTGCACCTGCCTAGTTTTCACTTGGCATGAAAAGAGAATACAGCCTTGCTTGAGGTAGA

Reverse complement sequence

TCTACCTCAAGCAAGGCTGTATTCTCTTTTCATGCCAAGTGAAAACTAGGCAGGTGCACTTGCTCCGGCACTTCATTTTCTTCTTCAGTCCATACTCATG[C/T]
AAGTAGCTTGCTTGGATGATTTTGAGTAAATTTAGGATGTTACTGGAGGGCACAAAGGAATTCAGGTAGATCAAGCTATTGTGCATGTAAAATGTGTATC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.60%	39.40%	0.00%	0.00%	NA
All Indica	2759	94.30%	5.70%	0.00%	0.00%	NA
All Japonica	1512	4.70%	95.30%	0.00%	0.00%	NA
Aus	269	51.30%	48.70%	0.00%	0.00%	NA
Indica I	595	98.30%	1.70%	0.00%	0.00%	NA
Indica II	465	93.30%	6.70%	0.00%	0.00%	NA
Indica III	913	95.40%	4.60%	0.00%	0.00%	NA
Indica Intermediate	786	90.60%	9.40%	0.00%	0.00%	NA
Temperate Japonica	767	3.30%	96.70%	0.00%	0.00%	NA
Tropical Japonica	504	7.90%	92.10%	0.00%	0.00%	NA
Japonica Intermediate	241	2.50%	97.50%	0.00%	0.00%	NA
VI/Aromatic	96	2.10%	97.90%	0.00%	0.00%	NA
Intermediate	90	56.70%	43.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0628393090	G -> A	LOC_Os06g46740.1	upstream_gene_variant ; 3516.0bp to feature; MODIFIER	silent_mutation	Average:43.835; most accessible tissue: Minghui63 young leaf, score: 57.221	N	N	N	N
vg0628393090	G -> A	LOC_Os06g46754.1	upstream_gene_variant ; 485.0bp to feature; MODIFIER	silent_mutation	Average:43.835; most accessible tissue: Minghui63 young leaf, score: 57.221	N	N	N	N
vg0628393090	G -> A	LOC_Os06g46754.2	intron_variant ; MODIFIER	silent_mutation	Average:43.835; most accessible tissue: Minghui63 young leaf, score: 57.221	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0628393090	1.88E-06	8.32E-07	mr1210	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628393090	NA	7.47E-18	mr1566	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628393090	NA	2.88E-07	mr1586	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628393090	NA	1.19E-18	mr1598	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628393090	NA	1.01E-11	mr1609	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628393090	NA	5.53E-07	mr1036_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628393090	NA	1.14E-15	mr1040_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628393090	3.18E-06	9.65E-07	mr1305_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628393090	NA	2.43E-21	mr1362_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628393090	6.21E-06	NA	mr1409_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628393090	NA	2.95E-22	mr1551_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628393090	NA	2.18E-16	mr1592_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628393090	NA	2.96E-25	mr1609_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628393090	NA	3.04E-07	mr1804_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628393090	NA	3.67E-07	mr1819_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628393090	NA	2.89E-24	mr1916_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628393090	NA	1.29E-14	mr1938_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628393090	NA	7.89E-09	mr1947_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251