Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0628353577:

Variant ID: vg0628353577 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 28353577
Reference Allele: G	Alternative Allele: C
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, C: 0.06, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:

AATGATGCCACGTCATGTCCGTGTGGCATGCCACATCAATACCACGTAGGATTCTAAAGGGGTTGTGGCGATTTGGGACCTAGATGACACACTATGACAA[G/C]
TTCTGGGATTTGGATATGCATTTTGAGAGTTTAGGGACCAAGATGACACACCTCTACAAGTTTAAGGACCGCTCGTACACTTTACTCAAATGAGTAAAAT

Reverse complement sequence

ATTTTACTCATTTGAGTAAAGTGTACGAGCGGTCCTTAAACTTGTAGAGGTGTGTCATCTTGGTCCCTAAACTCTCAAAATGCATATCCAAATCCCAGAA[C/G]
TTGTCATAGTGTGTCATCTAGGTCCCAAATCGCCACAACCCCTTTAGAATCCTACGTGGTATTGATGTGGCATGCCACACGGACATGACGTGGCATCATT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.70%	42.20%	0.08%	0.00%	NA
All Indica	2759	92.20%	7.70%	0.07%	0.00%	NA
All Japonica	1512	2.30%	97.70%	0.00%	0.00%	NA
Aus	269	36.10%	63.90%	0.00%	0.00%	NA
Indica I	595	98.80%	0.80%	0.34%	0.00%	NA
Indica II	465	93.80%	6.20%	0.00%	0.00%	NA
Indica III	913	87.10%	12.90%	0.00%	0.00%	NA
Indica Intermediate	786	92.40%	7.60%	0.00%	0.00%	NA
Temperate Japonica	767	3.40%	96.60%	0.00%	0.00%	NA
Tropical Japonica	504	0.60%	99.40%	0.00%	0.00%	NA
Japonica Intermediate	241	2.50%	97.50%	0.00%	0.00%	NA
VI/Aromatic	96	4.20%	95.80%	0.00%	0.00%	NA
Intermediate	90	51.10%	46.70%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0628353577	G -> C	LOC_Os06g46680.1	upstream_gene_variant ; 1162.0bp to feature; MODIFIER	silent_mutation	Average:48.808; most accessible tissue: Zhenshan97 panicle, score: 72.468	N	N	N	N
vg0628353577	G -> C	LOC_Os06g46670.2	downstream_gene_variant ; 2333.0bp to feature; MODIFIER	silent_mutation	Average:48.808; most accessible tissue: Zhenshan97 panicle, score: 72.468	N	N	N	N
vg0628353577	G -> C	LOC_Os06g46670.3	downstream_gene_variant ; 4416.0bp to feature; MODIFIER	silent_mutation	Average:48.808; most accessible tissue: Zhenshan97 panicle, score: 72.468	N	N	N	N
vg0628353577	G -> C	LOC_Os06g46670-LOC_Os06g46680	intergenic_region ; MODIFIER	silent_mutation	Average:48.808; most accessible tissue: Zhenshan97 panicle, score: 72.468	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0628353577	NA	3.96E-11	mr1609	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628353577	NA	9.03E-17	mr1825	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628353577	NA	5.92E-16	mr1916	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628353577	NA	9.37E-06	mr1036_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628353577	NA	1.97E-18	mr1040_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628353577	NA	1.91E-18	mr1131_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628353577	NA	4.59E-18	mr1199_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628353577	NA	4.25E-23	mr1362_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628353577	NA	8.36E-06	mr1362_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628353577	NA	6.45E-20	mr1581_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628353577	NA	1.56E-24	mr1609_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628353577	NA	1.68E-06	mr1754_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628353577	NA	2.58E-07	mr1804_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628353577	NA	2.97E-07	mr1819_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628353577	NA	5.90E-16	mr1836_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628353577	NA	7.38E-06	mr1852_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628353577	NA	1.13E-24	mr1916_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628353577	NA	5.03E-14	mr1938_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251