\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0628353577:

Variant ID: vg0628353577 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 28353577
Reference Allele: GAlternative Allele: C
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, C: 0.06, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:


AATGATGCCACGTCATGTCCGTGTGGCATGCCACATCAATACCACGTAGGATTCTAAAGGGGTTGTGGCGATTTGGGACCTAGATGACACACTATGACAA[G/C]
TTCTGGGATTTGGATATGCATTTTGAGAGTTTAGGGACCAAGATGACACACCTCTACAAGTTTAAGGACCGCTCGTACACTTTACTCAAATGAGTAAAAT

Reverse complement sequence

ATTTTACTCATTTGAGTAAAGTGTACGAGCGGTCCTTAAACTTGTAGAGGTGTGTCATCTTGGTCCCTAAACTCTCAAAATGCATATCCAAATCCCAGAA[C/G]
TTGTCATAGTGTGTCATCTAGGTCCCAAATCGCCACAACCCCTTTAGAATCCTACGTGGTATTGATGTGGCATGCCACACGGACATGACGTGGCATCATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.70% 42.20% 0.08% 0.00% NA
All Indica  2759 92.20% 7.70% 0.07% 0.00% NA
All Japonica  1512 2.30% 97.70% 0.00% 0.00% NA
Aus  269 36.10% 63.90% 0.00% 0.00% NA
Indica I  595 98.80% 0.80% 0.34% 0.00% NA
Indica II  465 93.80% 6.20% 0.00% 0.00% NA
Indica III  913 87.10% 12.90% 0.00% 0.00% NA
Indica Intermediate  786 92.40% 7.60% 0.00% 0.00% NA
Temperate Japonica  767 3.40% 96.60% 0.00% 0.00% NA
Tropical Japonica  504 0.60% 99.40% 0.00% 0.00% NA
Japonica Intermediate  241 2.50% 97.50% 0.00% 0.00% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 51.10% 46.70% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0628353577 G -> C LOC_Os06g46680.1 upstream_gene_variant ; 1162.0bp to feature; MODIFIER silent_mutation Average:48.808; most accessible tissue: Zhenshan97 panicle, score: 72.468 N N N N
vg0628353577 G -> C LOC_Os06g46670.2 downstream_gene_variant ; 2333.0bp to feature; MODIFIER silent_mutation Average:48.808; most accessible tissue: Zhenshan97 panicle, score: 72.468 N N N N
vg0628353577 G -> C LOC_Os06g46670.3 downstream_gene_variant ; 4416.0bp to feature; MODIFIER silent_mutation Average:48.808; most accessible tissue: Zhenshan97 panicle, score: 72.468 N N N N
vg0628353577 G -> C LOC_Os06g46670-LOC_Os06g46680 intergenic_region ; MODIFIER silent_mutation Average:48.808; most accessible tissue: Zhenshan97 panicle, score: 72.468 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0628353577 NA 3.96E-11 mr1609 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628353577 NA 9.03E-17 mr1825 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628353577 NA 5.92E-16 mr1916 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628353577 NA 9.37E-06 mr1036_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628353577 NA 1.97E-18 mr1040_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628353577 NA 1.91E-18 mr1131_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628353577 NA 4.59E-18 mr1199_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628353577 NA 4.25E-23 mr1362_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628353577 NA 8.36E-06 mr1362_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628353577 NA 6.45E-20 mr1581_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628353577 NA 1.56E-24 mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628353577 NA 1.68E-06 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628353577 NA 2.58E-07 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628353577 NA 2.97E-07 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628353577 NA 5.90E-16 mr1836_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628353577 NA 7.38E-06 mr1852_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628353577 NA 1.13E-24 mr1916_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628353577 NA 5.03E-14 mr1938_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251