\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0628133558:

Variant ID: vg0628133558 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 28133558
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.03, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


AAGATGAGCAAACAGTATAAACTGTGGTGCGTGCGGCGGCGTGGTTTGAGCAAGTTTAATAGTATAGCCAACTAATAGCTCCAAATTATCTATAGCCAAT[G/A]
TAATAGCTAATTCATACAATAGTTGCTTACTATATTATTAATACCTTGTCCTACCTATCATAAACACATTACGTCTTAGAGTCCGTGCTACACCTGATCA

Reverse complement sequence

TGATCAGGTGTAGCACGGACTCTAAGACGTAATGTGTTTATGATAGGTAGGACAAGGTATTAATAATATAGTAAGCAACTATTGTATGAATTAGCTATTA[C/T]
ATTGGCTATAGATAATTTGGAGCTATTAGTTGGCTATACTATTAAACTTGCTCAAACCACGCCGCCGCACGCACCACAGTTTATACTGTTTGCTCATCTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.20% 44.80% 0.04% 0.00% NA
All Indica  2759 91.00% 8.90% 0.04% 0.00% NA
All Japonica  1512 2.30% 97.70% 0.00% 0.00% NA
Aus  269 4.80% 95.20% 0.00% 0.00% NA
Indica I  595 95.00% 5.00% 0.00% 0.00% NA
Indica II  465 93.10% 6.70% 0.22% 0.00% NA
Indica III  913 90.00% 10.00% 0.00% 0.00% NA
Indica Intermediate  786 88.00% 12.00% 0.00% 0.00% NA
Temperate Japonica  767 3.50% 96.50% 0.00% 0.00% NA
Tropical Japonica  504 0.80% 99.20% 0.00% 0.00% NA
Japonica Intermediate  241 1.70% 98.30% 0.00% 0.00% NA
VI/Aromatic  96 1.00% 97.90% 1.04% 0.00% NA
Intermediate  90 53.30% 46.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0628133558 G -> A LOC_Os06g46360.1 upstream_gene_variant ; 3479.0bp to feature; MODIFIER silent_mutation Average:84.694; most accessible tissue: Zhenshan97 flower, score: 91.879 N N N N
vg0628133558 G -> A LOC_Os06g46366.1 upstream_gene_variant ; 243.0bp to feature; MODIFIER silent_mutation Average:84.694; most accessible tissue: Zhenshan97 flower, score: 91.879 N N N N
vg0628133558 G -> A LOC_Os06g46360-LOC_Os06g46366 intergenic_region ; MODIFIER silent_mutation Average:84.694; most accessible tissue: Zhenshan97 flower, score: 91.879 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0628133558 G A 0.02 0.01 0.01 0.0 0.0 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0628133558 NA 1.98E-11 mr1233 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628133558 NA 1.28E-06 mr1321 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628133558 NA 2.18E-13 mr1362 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628133558 NA 1.37E-09 mr1379 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628133558 NA 8.51E-18 mr1566 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628133558 NA 1.54E-11 mr1609 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628133558 NA 3.98E-17 mr1700 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628133558 NA 1.17E-06 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628133558 NA 4.29E-23 mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628133558 NA 5.52E-12 mr1883 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628133558 NA 4.23E-17 mr1916 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628133558 NA 6.42E-07 mr1036_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628133558 1.89E-06 4.97E-06 mr1233_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628133558 NA 7.07E-22 mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628133558 NA 1.64E-10 mr1649_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251