Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0628127868:

Variant ID: vg0628127868 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 28127868
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAGATAAAAAAAATGATTGTGATTGATTGAGAGAATGCGATGGACAAAAAAAATACTACCTCTATATTTTAATGTATGACGCCATTAATTTTTTATCCAA[C/T]
GTTTGACCATTCGTCTTATTTAAAAAATTTATGCAATTCTCATTTATTTTATTGTGACTAGATTCATCATCAAATGTTCTTTAAGCATGATATAAATATT

Reverse complement sequence

AATATTTATATCATGCTTAAAGAACATTTGATGATGAATCTAGTCACAATAAAATAAATGAGAATTGCATAAATTTTTTAAATAAGACGAATGGTCAAAC[G/A]
TTGGATAAAAAATTAATGGCGTCATACATTAAAATATAGAGGTAGTATTTTTTTTGTCCATCGCATTCTCTCAATCAATCACAATCATTTTTTTTATCTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.40% 40.10% 0.53% 0.00% NA
All Indica  2759 95.20% 4.70% 0.11% 0.00% NA
All Japonica  1512 6.90% 91.80% 1.26% 0.00% NA
Aus  269 8.20% 91.40% 0.37% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 95.90% 4.10% 0.00% 0.00% NA
Indica III  913 93.60% 6.40% 0.00% 0.00% NA
Indica Intermediate  786 93.40% 6.20% 0.38% 0.00% NA
Temperate Japonica  767 3.70% 96.20% 0.13% 0.00% NA
Tropical Japonica  504 14.10% 82.70% 3.17% 0.00% NA
Japonica Intermediate  241 2.50% 96.70% 0.83% 0.00% NA
VI/Aromatic  96 1.00% 97.90% 1.04% 0.00% NA
Intermediate  90 56.70% 42.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0628127868 C -> T LOC_Os06g46360.1 downstream_gene_variant ; 1204.0bp to feature; MODIFIER silent_mutation Average:72.305; most accessible tissue: Zhenshan97 flag leaf, score: 92.415 N N N N
vg0628127868 C -> T LOC_Os06g46350-LOC_Os06g46360 intergenic_region ; MODIFIER silent_mutation Average:72.305; most accessible tissue: Zhenshan97 flag leaf, score: 92.415 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0628127868 C T 0.02 0.0 0.0 -0.01 0.0 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0628127868 NA 3.49E-12 mr1609 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628127868 NA 5.63E-08 mr1785 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628127868 NA 4.66E-11 mr1883 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628127868 NA 3.37E-15 mr1916 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628127868 1.14E-06 NA mr1388_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628127868 NA 5.93E-06 mr1388_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628127868 NA 6.41E-22 mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628127868 NA 7.87E-11 mr1649_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628127868 NA 1.65E-06 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251