Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0628086657:

Variant ID: vg0628086657 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 28086657
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGTGTAGTCGATAGTGTGACTGTAACTTGTGTAATTTGTGCAGGTGGAGGAATCTCTCCCTCCTTGTGACCTTCAGAATAAACTCATCTGAGGACAATAC[T/C]
AGGGACATTTGATAATATGTCATTCTTATTATATGAGTTTACCTTTAGAATTATTTATTAATCCCTCTGTTTTAGGTTATAAGATGTTTTGACTTTGCTC

Reverse complement sequence

GAGCAAAGTCAAAACATCTTATAACCTAAAACAGAGGGATTAATAAATAATTCTAAAGGTAAACTCATATAATAAGAATGACATATTATCAAATGTCCCT[A/G]
GTATTGTCCTCAGATGAGTTTATTCTGAAGGTCACAAGGAGGGAGAGATTCCTCCACCTGCACAAATTACACAAGTTACAGTCACACTATCGACTACACC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.20%	40.70%	0.15%	0.00%	NA
All Indica	2759	94.50%	5.30%	0.22%	0.00%	NA
All Japonica	1512	3.00%	97.00%	0.00%	0.00%	NA
Aus	269	7.40%	92.60%	0.00%	0.00%	NA
Indica I	595	99.20%	0.70%	0.17%	0.00%	NA
Indica II	465	95.50%	4.50%	0.00%	0.00%	NA
Indica III	913	93.10%	6.70%	0.22%	0.00%	NA
Indica Intermediate	786	92.00%	7.60%	0.38%	0.00%	NA
Temperate Japonica	767	3.70%	96.30%	0.00%	0.00%	NA
Tropical Japonica	504	1.60%	98.40%	0.00%	0.00%	NA
Japonica Intermediate	241	4.10%	95.90%	0.00%	0.00%	NA
VI/Aromatic	96	74.00%	26.00%	0.00%	0.00%	NA
Intermediate	90	58.90%	40.00%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0628086657	T -> C	LOC_Os06g46330.1	downstream_gene_variant ; 3462.0bp to feature; MODIFIER	silent_mutation	Average:41.572; most accessible tissue: Minghui63 panicle, score: 71.773	N	N	N	N
vg0628086657	T -> C	LOC_Os06g46310-LOC_Os06g46330	intergenic_region ; MODIFIER	silent_mutation	Average:41.572; most accessible tissue: Minghui63 panicle, score: 71.773	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0628086657	NA	2.48E-10	mr1175	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628086657	NA	2.32E-11	mr1233	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628086657	NA	1.56E-25	mr1251	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628086657	NA	3.39E-31	mr1257	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628086657	NA	1.19E-06	mr1321	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628086657	NA	1.59E-10	mr1379	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628086657	NA	7.31E-11	mr1578	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628086657	NA	5.69E-17	mr1700	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628086657	NA	2.16E-07	mr1804	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628086657	NA	1.52E-10	mr1819	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628086657	NA	4.37E-36	mr1828	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628086657	NA	1.42E-23	mr1841	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628086657	NA	6.98E-19	mr1916	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628086657	NA	2.64E-12	mr1938	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628086657	NA	1.03E-20	mr1253_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628086657	NA	1.41E-09	mr1338_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628086657	NA	3.06E-07	mr1527_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628086657	NA	1.74E-15	mr1578_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628086657	NA	8.95E-10	mr1649_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251