\
| Variant ID: vg0628049668 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 28049668 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 105. )
CACGCTGGCTTGTGGTAAGCACGATAAGTTCTTCCAGGGCATCCCGCGAACCGGTCCTTAATCGCCATGGGCACGACTAGCAAAATCATGCACCCACAGC[T/C]
CACCATGTAGTGTATTTTAATTAACCAACACCATAGCGGTGGCGCTAATCCAACAATACCATTAGAACCAACAGTCTAAACATTAATAGGATTCTCCCTA
TAGGGAGAATCCTATTAATGTTTAGACTGTTGGTTCTAATGGTATTGTTGGATTAGCGCCACCGCTATGGTGTTGGTTAATTAAAATACACTACATGGTG[A/G]
GCTGTGGGTGCATGATTTTGCTAGTCGTGCCCATGGCGATTAAGGACCGGTTCGCGGGATGCCCTGGAAGAACTTATCGTGCTTACCACAAGCCAGCGTG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 27.90% | 6.20% | 8.76% | 57.22% | NA |
| All Indica | 2759 | 1.80% | 0.30% | 13.41% | 84.52% | NA |
| All Japonica | 1512 | 81.00% | 12.60% | 1.46% | 4.89% | NA |
| Aus | 269 | 0.70% | 1.50% | 5.95% | 91.82% | NA |
| Indica I | 595 | 1.50% | 0.00% | 6.72% | 91.76% | NA |
| Indica II | 465 | 3.20% | 0.00% | 4.73% | 92.04% | NA |
| Indica III | 913 | 1.10% | 0.20% | 23.11% | 75.58% | NA |
| Indica Intermediate | 786 | 1.90% | 0.80% | 12.34% | 84.99% | NA |
| Temperate Japonica | 767 | 77.20% | 19.40% | 0.13% | 3.26% | NA |
| Tropical Japonica | 504 | 82.50% | 6.00% | 3.97% | 7.54% | NA |
| Japonica Intermediate | 241 | 90.00% | 5.00% | 0.41% | 4.56% | NA |
| VI/Aromatic | 96 | 14.60% | 81.20% | 1.04% | 3.12% | NA |
| Intermediate | 90 | 30.00% | 11.10% | 5.56% | 53.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0628049668 | T -> C | LOC_Os06g46284.1 | intron_variant ; MODIFIER | silent_mutation | Average:13.064; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| vg0628049668 | T -> C | LOC_Os06g46284.2 | intron_variant ; MODIFIER | silent_mutation | Average:13.064; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| vg0628049668 | T -> DEL | N | N | silent_mutation | Average:13.064; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0628049668 | NA | 2.80E-17 | Awn_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0628049668 | 8.31E-09 | NA | mr1210 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628049668 | NA | 2.11E-07 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628049668 | 3.45E-06 | NA | mr1305 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628049668 | NA | 1.27E-11 | mr1585 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628049668 | NA | 1.27E-06 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628049668 | 3.89E-09 | NA | mr1586 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628049668 | NA | 5.50E-08 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628049668 | 2.04E-06 | NA | mr1672 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628049668 | 1.69E-06 | NA | mr1765 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628049668 | 5.95E-06 | NA | mr1166_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628049668 | 5.47E-07 | NA | mr1305_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628049668 | NA | 1.93E-06 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628049668 | 2.40E-06 | 2.22E-14 | mr1585_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628049668 | NA | 1.54E-07 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628049668 | 1.62E-07 | NA | mr1672_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |