Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0628044583:

Variant ID: vg0628044583 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 28044583
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CACAAACGTGCACAACTGCAACAAAATATAATAAAAATAATACTCCATCCGTCCCATAATATAAGGATTTTGAGTTTTTGCTTGTAACGTTTGACCACTC[A/G]
TCTTATTCAAAATTTTTTTGAAATTATTATTTATTTTATTTGTGACTTACTTTATTATCTACAGTACTTTAAGCACAACTTTTTGTTTTTTATATTTGCA

Reverse complement sequence

TGCAAATATAAAAAACAAAAAGTTGTGCTTAAAGTACTGTAGATAATAAAGTAAGTCACAAATAAAATAAATAATAATTTCAAAAAAATTTTGAATAAGA[T/C]
GAGTGGTCAAACGTTACAAGCAAAAACTCAAAATCCTTATATTATGGGACGGATGGAGTATTATTTTTATTATATTTTGTTGCAGTTGTGCACGTTTGTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.20%	33.10%	11.38%	5.27%	NA
All Indica	2759	74.10%	1.10%	16.53%	8.30%	NA
All Japonica	1512	2.40%	93.50%	3.31%	0.79%	NA
Aus	269	90.70%	1.90%	7.43%	0.00%	NA
Indica I	595	49.40%	0.50%	39.16%	10.92%	NA
Indica II	465	64.50%	1.50%	18.49%	15.48%	NA
Indica III	913	94.30%	0.20%	3.61%	1.86%	NA
Indica Intermediate	786	75.10%	2.20%	13.23%	9.54%	NA
Temperate Japonica	767	2.10%	96.50%	0.13%	1.30%	NA
Tropical Japonica	504	2.60%	88.30%	9.13%	0.00%	NA
Japonica Intermediate	241	2.90%	95.00%	1.24%	0.83%	NA
VI/Aromatic	96	9.40%	90.60%	0.00%	0.00%	NA
Intermediate	90	44.40%	33.30%	13.33%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0628044583	A -> G	LOC_Os06g46270.1	downstream_gene_variant ; 2674.0bp to feature; MODIFIER	silent_mutation	Average:58.856; most accessible tissue: Minghui63 root, score: 79.74	N	N	N	N
vg0628044583	A -> G	LOC_Os06g46284.1	downstream_gene_variant ; 564.0bp to feature; MODIFIER	silent_mutation	Average:58.856; most accessible tissue: Minghui63 root, score: 79.74	N	N	N	N
vg0628044583	A -> G	LOC_Os06g46284.2	downstream_gene_variant ; 564.0bp to feature; MODIFIER	silent_mutation	Average:58.856; most accessible tissue: Minghui63 root, score: 79.74	N	N	N	N
vg0628044583	A -> G	LOC_Os06g46270-LOC_Os06g46284	intergenic_region ; MODIFIER	silent_mutation	Average:58.856; most accessible tissue: Minghui63 root, score: 79.74	N	N	N	N
vg0628044583	A -> DEL	N	N	silent_mutation	Average:58.856; most accessible tissue: Minghui63 root, score: 79.74	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0628044583	NA	8.99E-78	mr1135	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628044583	NA	3.30E-07	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628044583	NA	1.53E-85	mr1504	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628044583	7.52E-06	8.58E-86	mr1672	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628044583	2.68E-06	2.67E-06	mr1672	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628044583	NA	4.82E-35	mr1682	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628044583	NA	1.70E-33	mr1733	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628044583	9.57E-06	5.18E-06	mr1733	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628044583	NA	6.56E-91	mr1758	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628044583	NA	3.32E-16	mr1162_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251