\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0628005554:

Variant ID: vg0628005554 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 28005554
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CATCTTAAGACTTTGTAACACTTATTAATAGCTTCTTTATTTGCTTCTGTCTATTTTTTTCTACATATTGGAGTAGTAATACCCATCTTCGGTTAATTCA[C/T]
AGGGGGCCAAACATATTTCTTCGTAACCACCTGATGTTTGTACATCGTTTCTCCTTCCTCTACACTTGCATCGAAAAACAGGACAAGATTTTTCCATTCT

Reverse complement sequence

AGAATGGAAAAATCTTGTCCTGTTTTTCGATGCAAGTGTAGAGGAAGGAGAAACGATGTACAAACATCAGGTGGTTACGAAGAAATATGTTTGGCCCCCT[G/A]
TGAATTAACCGAAGATGGGTATTACTACTCCAATATGTAGAAAAAAATAGACAGAAGCAAATAAAGAAGCTATTAATAAGTGTTACAAAGTCTTAAGATG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.90% 14.00% 0.08% 0.00% NA
All Indica  2759 82.20% 17.80% 0.04% 0.00% NA
All Japonica  1512 99.00% 1.00% 0.00% 0.00% NA
Aus  269 45.70% 53.20% 1.12% 0.00% NA
Indica I  595 92.90% 6.90% 0.17% 0.00% NA
Indica II  465 97.40% 2.60% 0.00% 0.00% NA
Indica III  913 73.90% 26.10% 0.00% 0.00% NA
Indica Intermediate  786 74.60% 25.40% 0.00% 0.00% NA
Temperate Japonica  767 99.10% 0.90% 0.00% 0.00% NA
Tropical Japonica  504 98.60% 1.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 88.90% 11.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0628005554 C -> T LOC_Os06g46230.1 upstream_gene_variant ; 1231.0bp to feature; MODIFIER silent_mutation Average:77.494; most accessible tissue: Callus, score: 88.606 N N N N
vg0628005554 C -> T LOC_Os06g46240.1 upstream_gene_variant ; 1731.0bp to feature; MODIFIER silent_mutation Average:77.494; most accessible tissue: Callus, score: 88.606 N N N N
vg0628005554 C -> T LOC_Os06g46230-LOC_Os06g46240 intergenic_region ; MODIFIER silent_mutation Average:77.494; most accessible tissue: Callus, score: 88.606 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0628005554 NA 1.14E-10 Heading_date Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0628005554 NA 8.31E-06 mr1015 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628005554 NA 1.23E-07 mr1244 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628005554 NA 3.10E-07 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628005554 NA 9.47E-06 mr1477 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628005554 NA 3.47E-07 mr1971 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628005554 NA 6.70E-06 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628005554 NA 2.15E-06 mr1277_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628005554 NA 2.00E-06 mr1533_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628005554 NA 2.23E-06 mr1566_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628005554 NA 7.12E-07 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628005554 NA 8.34E-06 mr1721_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251