\
| Variant ID: vg0627991730 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 27991730 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AAAGGGACATTTACAGGGGTACATAATGTTATAGGGGCTCATGGGCCCCTGATGGGCCGTCTGACGATCACCGGCCTGATGGGCTGGAAAGGCTTCCTCG[G/A]
CCCTCGCGGGGGCGAACTTGTCAAGGCGAAGTCATCCTCCTTCGGCAGACAGTCTTCGCCTTGCACCCTTCGCCTGAGACGCCTCTGGCTTGGTTCCTCG
CGAGGAACCAAGCCAGAGGCGTCTCAGGCGAAGGGTGCAAGGCGAAGACTGTCTGCCGAAGGAGGATGACTTCGCCTTGACAAGTTCGCCCCCGCGAGGG[C/T]
CGAGGAAGCCTTTCCAGCCCATCAGGCCGGTGATCGTCAGACGGCCCATCAGGGGCCCATGAGCCCCTATAACATTATGTACCCCTGTAAATGTCCCTTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.10% | 3.40% | 1.95% | 43.57% | NA |
| All Indica | 2759 | 37.90% | 0.00% | 2.43% | 59.66% | NA |
| All Japonica | 1512 | 84.80% | 10.10% | 0.33% | 4.76% | NA |
| Aus | 269 | 5.20% | 2.20% | 4.46% | 88.10% | NA |
| Indica I | 595 | 48.40% | 0.00% | 2.35% | 49.24% | NA |
| Indica II | 465 | 57.20% | 0.00% | 2.15% | 40.65% | NA |
| Indica III | 913 | 19.70% | 0.00% | 2.41% | 77.88% | NA |
| Indica Intermediate | 786 | 39.60% | 0.10% | 2.67% | 57.63% | NA |
| Temperate Japonica | 767 | 79.70% | 19.00% | 0.26% | 1.04% | NA |
| Tropical Japonica | 504 | 88.10% | 0.80% | 0.20% | 10.91% | NA |
| Japonica Intermediate | 241 | 94.20% | 1.20% | 0.83% | 3.73% | NA |
| VI/Aromatic | 96 | 16.70% | 0.00% | 7.29% | 76.04% | NA |
| Intermediate | 90 | 63.30% | 1.10% | 1.11% | 34.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0627991730 | G -> A | LOC_Os06g46180.1 | upstream_gene_variant ; 413.0bp to feature; MODIFIER | silent_mutation | Average:40.306; most accessible tissue: Zhenshan97 root, score: 73.6 | N | N | N | N |
| vg0627991730 | G -> A | LOC_Os06g46190.1 | upstream_gene_variant ; 3118.0bp to feature; MODIFIER | silent_mutation | Average:40.306; most accessible tissue: Zhenshan97 root, score: 73.6 | N | N | N | N |
| vg0627991730 | G -> A | LOC_Os06g46180-LOC_Os06g46190 | intergenic_region ; MODIFIER | silent_mutation | Average:40.306; most accessible tissue: Zhenshan97 root, score: 73.6 | N | N | N | N |
| vg0627991730 | G -> DEL | N | N | silent_mutation | Average:40.306; most accessible tissue: Zhenshan97 root, score: 73.6 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0627991730 | NA | 3.08E-07 | mr1062 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627991730 | NA | 6.86E-07 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627991730 | NA | 2.88E-07 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627991730 | 4.77E-06 | 4.77E-06 | mr1409 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627991730 | NA | 2.13E-06 | mr1515 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627991730 | NA | 9.60E-08 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627991730 | NA | 9.90E-08 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627991730 | NA | 2.94E-07 | mr1765 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627991730 | 1.00E-06 | 1.00E-06 | mr1166_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627991730 | NA | 7.22E-09 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627991730 | NA | 8.75E-10 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627991730 | NA | 2.15E-07 | mr1765_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |