\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0627991730:

Variant ID: vg0627991730 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 27991730
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAGGGACATTTACAGGGGTACATAATGTTATAGGGGCTCATGGGCCCCTGATGGGCCGTCTGACGATCACCGGCCTGATGGGCTGGAAAGGCTTCCTCG[G/A]
CCCTCGCGGGGGCGAACTTGTCAAGGCGAAGTCATCCTCCTTCGGCAGACAGTCTTCGCCTTGCACCCTTCGCCTGAGACGCCTCTGGCTTGGTTCCTCG

Reverse complement sequence

CGAGGAACCAAGCCAGAGGCGTCTCAGGCGAAGGGTGCAAGGCGAAGACTGTCTGCCGAAGGAGGATGACTTCGCCTTGACAAGTTCGCCCCCGCGAGGG[C/T]
CGAGGAAGCCTTTCCAGCCCATCAGGCCGGTGATCGTCAGACGGCCCATCAGGGGCCCATGAGCCCCTATAACATTATGTACCCCTGTAAATGTCCCTTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.10% 3.40% 1.95% 43.57% NA
All Indica  2759 37.90% 0.00% 2.43% 59.66% NA
All Japonica  1512 84.80% 10.10% 0.33% 4.76% NA
Aus  269 5.20% 2.20% 4.46% 88.10% NA
Indica I  595 48.40% 0.00% 2.35% 49.24% NA
Indica II  465 57.20% 0.00% 2.15% 40.65% NA
Indica III  913 19.70% 0.00% 2.41% 77.88% NA
Indica Intermediate  786 39.60% 0.10% 2.67% 57.63% NA
Temperate Japonica  767 79.70% 19.00% 0.26% 1.04% NA
Tropical Japonica  504 88.10% 0.80% 0.20% 10.91% NA
Japonica Intermediate  241 94.20% 1.20% 0.83% 3.73% NA
VI/Aromatic  96 16.70% 0.00% 7.29% 76.04% NA
Intermediate  90 63.30% 1.10% 1.11% 34.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0627991730 G -> A LOC_Os06g46180.1 upstream_gene_variant ; 413.0bp to feature; MODIFIER silent_mutation Average:40.306; most accessible tissue: Zhenshan97 root, score: 73.6 N N N N
vg0627991730 G -> A LOC_Os06g46190.1 upstream_gene_variant ; 3118.0bp to feature; MODIFIER silent_mutation Average:40.306; most accessible tissue: Zhenshan97 root, score: 73.6 N N N N
vg0627991730 G -> A LOC_Os06g46180-LOC_Os06g46190 intergenic_region ; MODIFIER silent_mutation Average:40.306; most accessible tissue: Zhenshan97 root, score: 73.6 N N N N
vg0627991730 G -> DEL N N silent_mutation Average:40.306; most accessible tissue: Zhenshan97 root, score: 73.6 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0627991730 NA 3.08E-07 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627991730 NA 6.86E-07 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627991730 NA 2.88E-07 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627991730 4.77E-06 4.77E-06 mr1409 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627991730 NA 2.13E-06 mr1515 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627991730 NA 9.60E-08 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627991730 NA 9.90E-08 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627991730 NA 2.94E-07 mr1765 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627991730 1.00E-06 1.00E-06 mr1166_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627991730 NA 7.22E-09 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627991730 NA 8.75E-10 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627991730 NA 2.15E-07 mr1765_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251