Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0627991730:

Variant ID: vg0627991730 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 27991730
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAAGGGACATTTACAGGGGTACATAATGTTATAGGGGCTCATGGGCCCCTGATGGGCCGTCTGACGATCACCGGCCTGATGGGCTGGAAAGGCTTCCTCG[G/A]
CCCTCGCGGGGGCGAACTTGTCAAGGCGAAGTCATCCTCCTTCGGCAGACAGTCTTCGCCTTGCACCCTTCGCCTGAGACGCCTCTGGCTTGGTTCCTCG

Reverse complement sequence

CGAGGAACCAAGCCAGAGGCGTCTCAGGCGAAGGGTGCAAGGCGAAGACTGTCTGCCGAAGGAGGATGACTTCGCCTTGACAAGTTCGCCCCCGCGAGGG[C/T]
CGAGGAAGCCTTTCCAGCCCATCAGGCCGGTGATCGTCAGACGGCCCATCAGGGGCCCATGAGCCCCTATAACATTATGTACCCCTGTAAATGTCCCTTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.10%	3.40%	1.95%	43.57%	NA
All Indica	2759	37.90%	0.00%	2.43%	59.66%	NA
All Japonica	1512	84.80%	10.10%	0.33%	4.76%	NA
Aus	269	5.20%	2.20%	4.46%	88.10%	NA
Indica I	595	48.40%	0.00%	2.35%	49.24%	NA
Indica II	465	57.20%	0.00%	2.15%	40.65%	NA
Indica III	913	19.70%	0.00%	2.41%	77.88%	NA
Indica Intermediate	786	39.60%	0.10%	2.67%	57.63%	NA
Temperate Japonica	767	79.70%	19.00%	0.26%	1.04%	NA
Tropical Japonica	504	88.10%	0.80%	0.20%	10.91%	NA
Japonica Intermediate	241	94.20%	1.20%	0.83%	3.73%	NA
VI/Aromatic	96	16.70%	0.00%	7.29%	76.04%	NA
Intermediate	90	63.30%	1.10%	1.11%	34.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0627991730	G -> A	LOC_Os06g46180.1	upstream_gene_variant ; 413.0bp to feature; MODIFIER	silent_mutation	Average:40.306; most accessible tissue: Zhenshan97 root, score: 73.6	N	N	N	N
vg0627991730	G -> A	LOC_Os06g46190.1	upstream_gene_variant ; 3118.0bp to feature; MODIFIER	silent_mutation	Average:40.306; most accessible tissue: Zhenshan97 root, score: 73.6	N	N	N	N
vg0627991730	G -> A	LOC_Os06g46180-LOC_Os06g46190	intergenic_region ; MODIFIER	silent_mutation	Average:40.306; most accessible tissue: Zhenshan97 root, score: 73.6	N	N	N	N
vg0627991730	G -> DEL	N	N	silent_mutation	Average:40.306; most accessible tissue: Zhenshan97 root, score: 73.6	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0627991730	NA	3.08E-07	mr1062	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627991730	NA	6.86E-07	mr1210	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627991730	NA	2.88E-07	mr1305	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627991730	4.77E-06	4.77E-06	mr1409	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627991730	NA	2.13E-06	mr1515	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627991730	NA	9.60E-08	mr1585	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627991730	NA	9.90E-08	mr1586	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627991730	NA	2.94E-07	mr1765	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627991730	1.00E-06	1.00E-06	mr1166_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627991730	NA	7.22E-09	mr1305_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627991730	NA	8.75E-10	mr1585_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627991730	NA	2.15E-07	mr1765_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251