\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0627991714:

Variant ID: vg0627991714 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 27991714
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CATGATTACCCTTACAAAAGGGACATTTACAGGGGTACATAATGTTATAGGGGCTCATGGGCCCCTGATGGGCCGTCTGACGATCACCGGCCTGATGGGC[T/C]
GGAAAGGCTTCCTCGGCCCTCGCGGGGGCGAACTTGTCAAGGCGAAGTCATCCTCCTTCGGCAGACAGTCTTCGCCTTGCACCCTTCGCCTGAGACGCCT

Reverse complement sequence

AGGCGTCTCAGGCGAAGGGTGCAAGGCGAAGACTGTCTGCCGAAGGAGGATGACTTCGCCTTGACAAGTTCGCCCCCGCGAGGGCCGAGGAAGCCTTTCC[A/G]
GCCCATCAGGCCGGTGATCGTCAGACGGCCCATCAGGGGCCCATGAGCCCCTATAACATTATGTACCCCTGTAAATGTCCCTTTTGTAAGGGTAATCATG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.40% 3.50% 1.82% 44.27% NA
All Indica  2759 37.10% 0.00% 2.28% 60.57% NA
All Japonica  1512 84.50% 10.30% 0.26% 4.89% NA
Aus  269 4.80% 2.20% 4.09% 88.85% NA
Indica I  595 48.20% 0.00% 2.35% 49.41% NA
Indica II  465 57.20% 0.00% 2.37% 40.43% NA
Indica III  913 18.20% 0.00% 2.08% 79.74% NA
Indica Intermediate  786 38.80% 0.10% 2.42% 58.65% NA
Temperate Japonica  767 79.40% 19.30% 0.13% 1.17% NA
Tropical Japonica  504 87.90% 0.80% 0.40% 10.91% NA
Japonica Intermediate  241 93.80% 1.70% 0.41% 4.15% NA
VI/Aromatic  96 15.60% 0.00% 4.17% 80.21% NA
Intermediate  90 60.00% 1.10% 4.44% 34.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0627991714 T -> C LOC_Os06g46180.1 upstream_gene_variant ; 397.0bp to feature; MODIFIER silent_mutation Average:39.617; most accessible tissue: Zhenshan97 root, score: 72.671 N N N N
vg0627991714 T -> C LOC_Os06g46190.1 upstream_gene_variant ; 3134.0bp to feature; MODIFIER silent_mutation Average:39.617; most accessible tissue: Zhenshan97 root, score: 72.671 N N N N
vg0627991714 T -> C LOC_Os06g46180-LOC_Os06g46190 intergenic_region ; MODIFIER silent_mutation Average:39.617; most accessible tissue: Zhenshan97 root, score: 72.671 N N N N
vg0627991714 T -> DEL N N silent_mutation Average:39.617; most accessible tissue: Zhenshan97 root, score: 72.671 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0627991714 9.22E-08 NA mr1062 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627991714 NA 6.35E-08 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627991714 1.30E-06 NA mr1210 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627991714 NA 6.48E-07 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627991714 1.05E-07 NA mr1305 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627991714 NA 2.94E-06 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627991714 7.10E-06 NA mr1409 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627991714 3.09E-09 NA mr1586 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627991714 NA 1.80E-07 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627991714 NA 2.56E-06 mr1765 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627991714 NA 2.35E-06 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627991714 NA 4.78E-07 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627991714 NA 6.46E-06 mr1765_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251