Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0627990543:

Variant ID: vg0627990543 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 27990543
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACTTGCTGGGCCGCCATGGATGGGTCAAAGATTGACTGCGACCACATCATAGCAGCTTGGATTGGTGCTTGGTTTGTTCCGAAGCCTGAGGTTGGAACTT[C/G]
CTGCCGAACGGTTGGCACCTGAGCAGTGTTGACGAAGTCTAACTGCGGTCCTTGACTCCACGGCGAAGGTCCCGAGCCTGGCTGAATTGGTGGCAACCAA

Reverse complement sequence

TTGGTTGCCACCAATTCAGCCAGGCTCGGGACCTTCGCCGTGGAGTCAAGGACCGCAGTTAGACTTCGTCAACACTGCTCAGGTGCCAACCGTTCGGCAG[G/C]
AAGTTCCAACCTCAGGCTTCGGAACAAACCAAGCACCAATCCAAGCTGCTATGATGTGGTCGCAGTCAATCTTTGACCCATCCATGGCGGCCCAGCAAGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.30%	3.90%	2.43%	42.36%	NA
All Indica	2759	38.10%	0.70%	3.73%	57.45%	NA
All Japonica	1512	84.90%	10.10%	0.20%	4.76%	NA
Aus	269	7.80%	3.00%	1.12%	88.10%	NA
Indica I	595	49.70%	0.00%	2.86%	47.39%	NA
Indica II	465	60.00%	0.00%	2.15%	37.85%	NA
Indica III	913	17.50%	1.50%	3.72%	77.22%	NA
Indica Intermediate	786	40.30%	0.60%	5.34%	53.69%	NA
Temperate Japonica	767	79.80%	19.00%	0.26%	0.91%	NA
Tropical Japonica	504	88.30%	0.80%	0.00%	10.91%	NA
Japonica Intermediate	241	94.20%	1.20%	0.41%	4.15%	NA
VI/Aromatic	96	15.60%	0.00%	3.12%	81.25%	NA
Intermediate	90	58.90%	4.40%	3.33%	33.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0627990543	C -> G	LOC_Os06g46180.1	missense_variant ; p.Glu259Gln; MODERATE	nonsynonymous_codon ; E259Q	Average:31.315; most accessible tissue: Zhenshan97 flag leaf, score: 64.225	benign	-0.908	TOLERATED	1.00
vg0627990543	C -> DEL	LOC_Os06g46180.1	N	frameshift_variant	Average:31.315; most accessible tissue: Zhenshan97 flag leaf, score: 64.225	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0627990543	NA	2.84E-08	Awn_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0627990543	NA	1.34E-06	mr1057	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627990543	NA	1.79E-06	mr1062	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627990543	1.40E-06	NA	mr1210	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627990543	NA	5.26E-07	mr1210	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627990543	7.40E-07	NA	mr1305	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627990543	NA	3.43E-06	mr1305	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627990543	NA	2.78E-07	mr1585	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627990543	1.92E-08	NA	mr1586	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627990543	NA	7.11E-08	mr1586	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627990543	NA	1.82E-06	mr1765	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627990543	NA	1.86E-07	mr1057_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627990543	5.65E-06	5.65E-06	mr1166_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627990543	1.94E-07	NA	mr1305_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627990543	NA	9.20E-08	mr1305_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627990543	NA	5.90E-09	mr1585_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627990543	NA	8.29E-09	mr1585_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627990543	9.86E-07	NA	mr1765_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627990543	NA	4.00E-07	mr1765_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251