Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0627983079:

Variant ID: vg0627983079 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 27983079
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACAGCCGCGGCGAAAGTATTCGGCAGTCCTCCGCATCAGCCGGTTGCATCGCCGCTGACTGAGGCGAAGGGAAAAAGAGCGGTCGCTGAGACGTCCGCTT[T/C]
GGAATATTCGCTCTCGGTACCCCACTTCGCCCCTGGCGACTTCGAGACGCGAGCGGACCTCCTTCCTTTTGTAGAGGGGGTAAGCAATCTTGTACTGCCC

Reverse complement sequence

GGGCAGTACAAGATTGCTTACCCCCTCTACAAAAGGAAGGAGGTCCGCTCGCGTCTCGAAGTCGCCAGGGGCGAAGTGGGGTACCGAGAGCGAATATTCC[A/G]
AAGCGGACGTCTCAGCGACCGCTCTTTTTCCCTTCGCCTCAGTCAGCGGCGATGCAACCGGCTGATGCGGAGGACTGCCGAATACTTTCGCCGCGGCTGT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.30%	3.60%	3.62%	8.42%	NA
All Indica	2759	89.70%	0.30%	1.99%	7.94%	NA
All Japonica	1512	86.00%	10.10%	0.40%	3.51%	NA
Aus	269	33.10%	2.60%	38.29%	26.02%	NA
Indica I	595	95.00%	0.00%	0.84%	4.20%	NA
Indica II	465	98.30%	0.00%	0.43%	1.29%	NA
Indica III	913	87.40%	0.90%	3.61%	8.11%	NA
Indica Intermediate	786	83.50%	0.10%	1.91%	14.50%	NA
Temperate Japonica	767	80.30%	19.20%	0.00%	0.52%	NA
Tropical Japonica	504	89.90%	0.80%	1.19%	8.13%	NA
Japonica Intermediate	241	95.90%	0.80%	0.00%	3.32%	NA
VI/Aromatic	96	45.80%	0.00%	3.12%	51.04%	NA
Intermediate	90	84.40%	3.30%	4.44%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0627983079	T -> C	LOC_Os06g46160.1	upstream_gene_variant ; 3718.0bp to feature; MODIFIER	silent_mutation	Average:48.331; most accessible tissue: Zhenshan97 flag leaf, score: 73.119	N	N	N	N
vg0627983079	T -> C	LOC_Os06g46180.1	downstream_gene_variant ; 2347.0bp to feature; MODIFIER	silent_mutation	Average:48.331; most accessible tissue: Zhenshan97 flag leaf, score: 73.119	N	N	N	N
vg0627983079	T -> C	LOC_Os06g46160-LOC_Os06g46180	intergenic_region ; MODIFIER	silent_mutation	Average:48.331; most accessible tissue: Zhenshan97 flag leaf, score: 73.119	N	N	N	N
vg0627983079	T -> DEL	N	N	silent_mutation	Average:48.331; most accessible tissue: Zhenshan97 flag leaf, score: 73.119	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0627983079	NA	2.84E-08	Awn_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0627983079	3.80E-06	NA	mr1062	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627983079	NA	1.79E-06	mr1062	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627983079	NA	5.26E-07	mr1210	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627983079	2.26E-06	NA	mr1305	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627983079	NA	3.43E-06	mr1305	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627983079	NA	2.78E-07	mr1585	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627983079	3.34E-08	NA	mr1586	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627983079	NA	7.11E-08	mr1586	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627983079	NA	1.82E-06	mr1765	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627983079	NA	2.54E-06	mr1912	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627983079	1.69E-06	NA	mr1950	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627983079	5.65E-06	5.65E-06	mr1166_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627983079	NA	9.20E-08	mr1305_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627983079	NA	8.29E-09	mr1585_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627983079	NA	4.00E-07	mr1765_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251