\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0627981060:

Variant ID: vg0627981060 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 27981060
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.75, A: 0.24, others allele: 0.00, population size: 68. )

Flanking Sequence (100 bp) in Reference Genome:


CTGCGAATGAAGTTTGTTATTTGTGCGGCTGGTATTATTTTGCCGCGCTTCGCCTCGTGCGATTGATGGTTATATATATTCTTTTTTCCTGGGCCGAACA[A/G]
AACAGTATTGGGCCTTCCTATCTTGGGCTTTTTACTGTGCCGCTCGGTCGATGGGAATTTACCGTTTCGCCTACCCTTGCGACACGTGGCGCTTCATTAC

Reverse complement sequence

GTAATGAAGCGCCACGTGTCGCAAGGGTAGGCGAAACGGTAAATTCCCATCGACCGAGCGGCACAGTAAAAAGCCCAAGATAGGAAGGCCCAATACTGTT[T/C]
TGTTCGGCCCAGGAAAAAAGAATATATATAACCATCAATCGCACGAGGCGAAGCGCGGCAAAATAATACCAGCCGCACAAATAACAAACTTCATTCGCAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.30% 30.00% 9.01% 11.70% NA
All Indica  2759 35.40% 44.30% 9.21% 11.09% NA
All Japonica  1512 84.90% 10.60% 0.33% 4.17% NA
Aus  269 0.70% 3.30% 55.02% 40.89% NA
Indica I  595 46.60% 46.10% 1.68% 5.71% NA
Indica II  465 54.80% 41.70% 2.80% 0.65% NA
Indica III  913 16.10% 53.70% 15.01% 15.22% NA
Indica Intermediate  786 37.90% 33.60% 11.96% 16.54% NA
Temperate Japonica  767 79.90% 19.30% 0.26% 0.52% NA
Tropical Japonica  504 87.90% 1.80% 0.60% 9.72% NA
Japonica Intermediate  241 94.60% 1.20% 0.00% 4.15% NA
VI/Aromatic  96 17.70% 3.10% 11.46% 67.71% NA
Intermediate  90 55.60% 25.60% 8.89% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0627981060 A -> G LOC_Os06g46160.1 upstream_gene_variant ; 1699.0bp to feature; MODIFIER silent_mutation Average:53.366; most accessible tissue: Minghui63 flag leaf, score: 66.556 N N N N
vg0627981060 A -> G LOC_Os06g46180.1 downstream_gene_variant ; 4366.0bp to feature; MODIFIER silent_mutation Average:53.366; most accessible tissue: Minghui63 flag leaf, score: 66.556 N N N N
vg0627981060 A -> G LOC_Os06g46160-LOC_Os06g46180 intergenic_region ; MODIFIER silent_mutation Average:53.366; most accessible tissue: Minghui63 flag leaf, score: 66.556 N N N N
vg0627981060 A -> DEL N N silent_mutation Average:53.366; most accessible tissue: Minghui63 flag leaf, score: 66.556 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0627981060 NA 8.83E-12 Awn_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0627981060 NA 5.59E-08 mr1462_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627981060 NA 2.23E-08 mr1582_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627981060 NA 2.27E-07 mr1582_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251