\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0627972942:

Variant ID: vg0627972942 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 27972942
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTGGATTCCTCTTATGGTGTGTTTAGTTTATGCCAAAATTGGAAGTTTGATTGAAATTGGAACGATGTGACAGAAAAGTTGAAAATTTGTGTGTAGAAAA[G/T]
TTTTGATGTGATGGAAAAGTTGAAAGTTTGAAGAAAAAGTTTGGAACTAAACCATGCCTTAATGTTGTACTCTGCGAGGGTGCAGCCATCCTCGAGCTAG

Reverse complement sequence

CTAGCTCGAGGATGGCTGCACCCTCGCAGAGTACAACATTAAGGCATGGTTTAGTTCCAAACTTTTTCTTCAAACTTTCAACTTTTCCATCACATCAAAA[C/A]
TTTTCTACACACAAATTTTCAACTTTTCTGTCACATCGTTCCAATTTCAATCAAACTTCCAATTTTGGCATAAACTAAACACACCATAAGAGGAATCCAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.20% 3.80% 1.99% 40.99% NA
All Indica  2759 37.80% 0.10% 2.28% 59.80% NA
All Japonica  1512 87.00% 11.20% 0.40% 1.39% NA
Aus  269 3.70% 2.20% 6.32% 87.73% NA
Indica I  595 49.70% 0.00% 0.67% 49.58% NA
Indica II  465 58.30% 0.00% 2.58% 39.14% NA
Indica III  913 17.70% 0.00% 2.85% 79.41% NA
Indica Intermediate  786 40.10% 0.30% 2.67% 57.00% NA
Temperate Japonica  767 77.70% 21.30% 0.00% 1.04% NA
Tropical Japonica  504 96.00% 1.00% 0.60% 2.38% NA
Japonica Intermediate  241 97.50% 0.80% 1.24% 0.41% NA
VI/Aromatic  96 83.30% 0.00% 7.29% 9.38% NA
Intermediate  90 74.40% 1.10% 1.11% 23.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0627972942 G -> T LOC_Os06g46149.1 downstream_gene_variant ; 1619.0bp to feature; MODIFIER silent_mutation Average:35.097; most accessible tissue: Zhenshan97 young leaf, score: 80.325 N N N N
vg0627972942 G -> T LOC_Os06g46160.1 downstream_gene_variant ; 3004.0bp to feature; MODIFIER silent_mutation Average:35.097; most accessible tissue: Zhenshan97 young leaf, score: 80.325 N N N N
vg0627972942 G -> T LOC_Os06g46149.2 downstream_gene_variant ; 1619.0bp to feature; MODIFIER silent_mutation Average:35.097; most accessible tissue: Zhenshan97 young leaf, score: 80.325 N N N N
vg0627972942 G -> T LOC_Os06g46149-LOC_Os06g46160 intergenic_region ; MODIFIER silent_mutation Average:35.097; most accessible tissue: Zhenshan97 young leaf, score: 80.325 N N N N
vg0627972942 G -> DEL N N silent_mutation Average:35.097; most accessible tissue: Zhenshan97 young leaf, score: 80.325 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0627972942 G T -0.03 -0.03 0.0 -0.03 -0.03 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0627972942 NA 2.47E-08 Awn_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0627972942 NA 1.70E-06 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627972942 NA 1.12E-06 mr1052 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627972942 6.90E-07 NA mr1062 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627972942 NA 3.25E-06 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627972942 2.05E-07 NA mr1210 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627972942 NA 1.75E-07 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627972942 5.41E-08 NA mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627972942 NA 1.98E-06 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627972942 NA 6.24E-08 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627972942 2.16E-09 NA mr1586 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627972942 NA 7.01E-08 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627972942 NA 3.27E-06 mr1765 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627972942 1.82E-06 1.82E-06 mr1166_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627972942 7.88E-07 NA mr1305_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627972942 NA 1.42E-07 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627972942 NA 5.08E-08 mr1585_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627972942 NA 2.27E-08 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627972942 8.35E-06 NA mr1765_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627972942 NA 7.67E-07 mr1765_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251