\
| Variant ID: vg0627957904 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr06 | Position: 27957904 |
| Reference Allele: G | Alternative Allele: A,GCA |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CAAGTTCTCGTCTAAACTTATATAATATGGTGTAATGGTGACCATGGGATTTCGGGCCTGTTCACTTTGATGACAAAAAAAAAAAACCTTACCAAATTTT[G/A,GCA]
ACAATGTCAAAATTTTGGCAACTATGCCAAAATTTTGGTAGGATTTCTTATATAGTTACCAAAATTTGGTAGCAAAATAAATATAACCACTTTTTTGACA
TGTCAAAAAAGTGGTTATATTTATTTTGCTACCAAATTTTGGTAACTATATAAGAAATCCTACCAAAATTTTGGCATAGTTGCCAAAATTTTGACATTGT[C/T,TGC]
AAAATTTGGTAAGGTTTTTTTTTTTTGTCATCAAAGTGAACAGGCCCGAAATCCCATGGTCACCATTACACCATATTATATAAGTTTAGACGAGAACTTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 70.90% | 9.20% | 0.97% | 13.44% | GCA: 5.48% |
| All Indica | 2759 | 69.50% | 11.10% | 0.69% | 15.80% | GCA: 2.94% |
| All Japonica | 1512 | 86.80% | 8.30% | 0.79% | 0.73% | GCA: 3.44% |
| Aus | 269 | 8.20% | 0.40% | 4.46% | 41.64% | GCA: 45.35% |
| Indica I | 595 | 92.90% | 6.10% | 0.00% | 0.84% | GCA: 0.17% |
| Indica II | 465 | 80.40% | 0.90% | 1.29% | 16.77% | GCA: 0.65% |
| Indica III | 913 | 54.00% | 13.10% | 0.99% | 27.38% | GCA: 4.49% |
| Indica Intermediate | 786 | 63.40% | 18.40% | 0.51% | 13.10% | GCA: 4.58% |
| Temperate Japonica | 767 | 82.80% | 15.50% | 1.43% | 0.00% | GCA: 0.26% |
| Tropical Japonica | 504 | 88.70% | 0.80% | 0.20% | 1.19% | GCA: 9.13% |
| Japonica Intermediate | 241 | 95.40% | 0.80% | 0.00% | 2.07% | GCA: 1.66% |
| VI/Aromatic | 96 | 30.20% | 0.00% | 1.04% | 67.71% | GCA: 1.04% |
| Intermediate | 90 | 80.00% | 2.20% | 2.22% | 12.22% | GCA: 3.33% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0627957904 | G -> GCA | LOC_Os06g46120.1 | upstream_gene_variant ; 1722.0bp to feature; MODIFIER | silent_mutation | Average:38.131; most accessible tissue: Zhenshan97 root, score: 70.636 | N | N | N | N |
| vg0627957904 | G -> GCA | LOC_Os06g46149.1 | upstream_gene_variant ; 2969.0bp to feature; MODIFIER | silent_mutation | Average:38.131; most accessible tissue: Zhenshan97 root, score: 70.636 | N | N | N | N |
| vg0627957904 | G -> GCA | LOC_Os06g46149.2 | upstream_gene_variant ; 2964.0bp to feature; MODIFIER | silent_mutation | Average:38.131; most accessible tissue: Zhenshan97 root, score: 70.636 | N | N | N | N |
| vg0627957904 | G -> GCA | LOC_Os06g46140.1 | downstream_gene_variant ; 4785.0bp to feature; MODIFIER | silent_mutation | Average:38.131; most accessible tissue: Zhenshan97 root, score: 70.636 | N | N | N | N |
| vg0627957904 | G -> GCA | LOC_Os06g46120-LOC_Os06g46149 | intergenic_region ; MODIFIER | silent_mutation | Average:38.131; most accessible tissue: Zhenshan97 root, score: 70.636 | N | N | N | N |
| vg0627957904 | G -> A | LOC_Os06g46120.1 | upstream_gene_variant ; 1721.0bp to feature; MODIFIER | silent_mutation | Average:38.131; most accessible tissue: Zhenshan97 root, score: 70.636 | N | N | N | N |
| vg0627957904 | G -> A | LOC_Os06g46149.1 | upstream_gene_variant ; 2970.0bp to feature; MODIFIER | silent_mutation | Average:38.131; most accessible tissue: Zhenshan97 root, score: 70.636 | N | N | N | N |
| vg0627957904 | G -> A | LOC_Os06g46149.2 | upstream_gene_variant ; 2965.0bp to feature; MODIFIER | silent_mutation | Average:38.131; most accessible tissue: Zhenshan97 root, score: 70.636 | N | N | N | N |
| vg0627957904 | G -> A | LOC_Os06g46140.1 | downstream_gene_variant ; 4786.0bp to feature; MODIFIER | silent_mutation | Average:38.131; most accessible tissue: Zhenshan97 root, score: 70.636 | N | N | N | N |
| vg0627957904 | G -> A | LOC_Os06g46120-LOC_Os06g46149 | intergenic_region ; MODIFIER | silent_mutation | Average:38.131; most accessible tissue: Zhenshan97 root, score: 70.636 | N | N | N | N |
| vg0627957904 | G -> DEL | N | N | silent_mutation | Average:38.131; most accessible tissue: Zhenshan97 root, score: 70.636 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0627957904 | NA | 3.31E-06 | mr1062 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627957904 | NA | 3.38E-07 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627957904 | 2.07E-08 | 2.07E-08 | mr1389 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627957904 | NA | 3.43E-07 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627957904 | 9.90E-06 | 1.73E-08 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627957904 | NA | 4.80E-07 | mr1765 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627957904 | NA | 4.60E-06 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627957904 | NA | 2.53E-07 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |