\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0627957904:

Variant ID: vg0627957904 (JBrowse)Variation Type: INDEL
Chromosome: chr06Position: 27957904
Reference Allele: GAlternative Allele: A,GCA
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAAGTTCTCGTCTAAACTTATATAATATGGTGTAATGGTGACCATGGGATTTCGGGCCTGTTCACTTTGATGACAAAAAAAAAAAACCTTACCAAATTTT[G/A,GCA]
ACAATGTCAAAATTTTGGCAACTATGCCAAAATTTTGGTAGGATTTCTTATATAGTTACCAAAATTTGGTAGCAAAATAAATATAACCACTTTTTTGACA

Reverse complement sequence

TGTCAAAAAAGTGGTTATATTTATTTTGCTACCAAATTTTGGTAACTATATAAGAAATCCTACCAAAATTTTGGCATAGTTGCCAAAATTTTGACATTGT[C/T,TGC]
AAAATTTGGTAAGGTTTTTTTTTTTTGTCATCAAAGTGAACAGGCCCGAAATCCCATGGTCACCATTACACCATATTATATAAGTTTAGACGAGAACTTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.90% 9.20% 0.97% 13.44% GCA: 5.48%
All Indica  2759 69.50% 11.10% 0.69% 15.80% GCA: 2.94%
All Japonica  1512 86.80% 8.30% 0.79% 0.73% GCA: 3.44%
Aus  269 8.20% 0.40% 4.46% 41.64% GCA: 45.35%
Indica I  595 92.90% 6.10% 0.00% 0.84% GCA: 0.17%
Indica II  465 80.40% 0.90% 1.29% 16.77% GCA: 0.65%
Indica III  913 54.00% 13.10% 0.99% 27.38% GCA: 4.49%
Indica Intermediate  786 63.40% 18.40% 0.51% 13.10% GCA: 4.58%
Temperate Japonica  767 82.80% 15.50% 1.43% 0.00% GCA: 0.26%
Tropical Japonica  504 88.70% 0.80% 0.20% 1.19% GCA: 9.13%
Japonica Intermediate  241 95.40% 0.80% 0.00% 2.07% GCA: 1.66%
VI/Aromatic  96 30.20% 0.00% 1.04% 67.71% GCA: 1.04%
Intermediate  90 80.00% 2.20% 2.22% 12.22% GCA: 3.33%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0627957904 G -> GCA LOC_Os06g46120.1 upstream_gene_variant ; 1722.0bp to feature; MODIFIER silent_mutation Average:38.131; most accessible tissue: Zhenshan97 root, score: 70.636 N N N N
vg0627957904 G -> GCA LOC_Os06g46149.1 upstream_gene_variant ; 2969.0bp to feature; MODIFIER silent_mutation Average:38.131; most accessible tissue: Zhenshan97 root, score: 70.636 N N N N
vg0627957904 G -> GCA LOC_Os06g46149.2 upstream_gene_variant ; 2964.0bp to feature; MODIFIER silent_mutation Average:38.131; most accessible tissue: Zhenshan97 root, score: 70.636 N N N N
vg0627957904 G -> GCA LOC_Os06g46140.1 downstream_gene_variant ; 4785.0bp to feature; MODIFIER silent_mutation Average:38.131; most accessible tissue: Zhenshan97 root, score: 70.636 N N N N
vg0627957904 G -> GCA LOC_Os06g46120-LOC_Os06g46149 intergenic_region ; MODIFIER silent_mutation Average:38.131; most accessible tissue: Zhenshan97 root, score: 70.636 N N N N
vg0627957904 G -> A LOC_Os06g46120.1 upstream_gene_variant ; 1721.0bp to feature; MODIFIER silent_mutation Average:38.131; most accessible tissue: Zhenshan97 root, score: 70.636 N N N N
vg0627957904 G -> A LOC_Os06g46149.1 upstream_gene_variant ; 2970.0bp to feature; MODIFIER silent_mutation Average:38.131; most accessible tissue: Zhenshan97 root, score: 70.636 N N N N
vg0627957904 G -> A LOC_Os06g46149.2 upstream_gene_variant ; 2965.0bp to feature; MODIFIER silent_mutation Average:38.131; most accessible tissue: Zhenshan97 root, score: 70.636 N N N N
vg0627957904 G -> A LOC_Os06g46140.1 downstream_gene_variant ; 4786.0bp to feature; MODIFIER silent_mutation Average:38.131; most accessible tissue: Zhenshan97 root, score: 70.636 N N N N
vg0627957904 G -> A LOC_Os06g46120-LOC_Os06g46149 intergenic_region ; MODIFIER silent_mutation Average:38.131; most accessible tissue: Zhenshan97 root, score: 70.636 N N N N
vg0627957904 G -> DEL N N silent_mutation Average:38.131; most accessible tissue: Zhenshan97 root, score: 70.636 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0627957904 NA 3.31E-06 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627957904 NA 3.38E-07 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627957904 2.07E-08 2.07E-08 mr1389 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627957904 NA 3.43E-07 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627957904 9.90E-06 1.73E-08 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627957904 NA 4.80E-07 mr1765 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627957904 NA 4.60E-06 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627957904 NA 2.53E-07 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251