Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0627929341:

Variant ID: vg0627929341 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 27929341
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTCCCCATTTTTTCACAACTCACGTCTCTCGTTTTTTACGCGCACACTTTTCAAACTAATAAACGGTAAACGGTGTGTTTTTTTGCAAAAAAGTTCAATA[C/T]
GAAAGTTGCTTTAAAAAATCATAATAATCCATTTTTTAAAAAAATTAGCTAATATTTAATTAATTTTGCACTAATGAATCGCTTCGTTTTACGTGTTAGA

Reverse complement sequence

TCTAACACGTAAAACGAAGCGATTCATTAGTGCAAAATTAATTAAATATTAGCTAATTTTTTTAAAAAATGGATTATTATGATTTTTTAAAGCAACTTTC[G/A]
TATTGAACTTTTTTGCAAAAAAACACACCGTTTACCGTTTATTAGTTTGAAAAGTGTGCGCGTAAAAAACGAGAGACGTGAGTTGTGAAAAAATGGGGAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.90%	1.90%	2.16%	0.00%	NA
All Indica	2759	98.50%	0.00%	1.45%	0.00%	NA
All Japonica	1512	90.10%	6.00%	3.97%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	95.10%	0.00%	4.87%	0.00%	NA
Indica II	465	98.70%	0.00%	1.29%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.20%	0.10%	0.64%	0.00%	NA
Temperate Japonica	767	90.70%	3.90%	5.35%	0.00%	NA
Tropical Japonica	504	88.90%	8.90%	2.18%	0.00%	NA
Japonica Intermediate	241	90.50%	6.20%	3.32%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	97.80%	1.10%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0627929341	C -> T	LOC_Os06g46060.1	upstream_gene_variant ; 3061.0bp to feature; MODIFIER	silent_mutation	Average:51.895; most accessible tissue: Minghui63 panicle, score: 82.797	N	N	N	N
vg0627929341	C -> T	LOC_Os06g46065.1	downstream_gene_variant ; 394.0bp to feature; MODIFIER	silent_mutation	Average:51.895; most accessible tissue: Minghui63 panicle, score: 82.797	N	N	N	N
vg0627929341	C -> T	LOC_Os06g46060-LOC_Os06g46065	intergenic_region ; MODIFIER	silent_mutation	Average:51.895; most accessible tissue: Minghui63 panicle, score: 82.797	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0627929341	4.76E-06	1.72E-06	mr1095	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627929341	2.19E-09	2.19E-09	mr1098	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627929341	1.43E-08	1.43E-08	mr1099	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627929341	8.96E-06	4.45E-08	mr1101	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627929341	NA	2.79E-06	mr1123	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627929341	5.68E-06	1.52E-07	mr1150	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627929341	1.31E-06	1.31E-06	mr1166	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627929341	NA	7.11E-06	mr1210	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627929341	1.07E-06	7.38E-08	mr1240	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627929341	6.31E-06	1.88E-07	mr1242	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627929341	NA	7.75E-06	mr1305	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627929341	NA	1.63E-06	mr1496	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627929341	NA	1.95E-07	mr1515	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627929341	1.41E-08	1.41E-08	mr1589	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627929341	1.22E-07	3.51E-08	mr1858	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627929341	1.22E-07	3.50E-08	mr1859	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627929341	1.43E-06	1.43E-06	mr1868	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627929341	NA	3.84E-06	mr1917	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627929341	NA	4.09E-06	mr1098_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627929341	NA	7.47E-06	mr1099_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251