\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0627911377:

Variant ID: vg0627911377 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 27911377
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATAATGAATTTGACGTTAAGATTTTAACCCTATGTGTAATACAATTGAAAGTATGTGTATGATTTTTTCTAGATTTTTTGGTGATATTTTTTAGTTAGT[G/A]
TGCACGTGTGTATACGTGAGGGCCTGTGTGTATAGGATATGTTGCCTTGAATATTTGCCGTCCGTGTTTTGCTCAGTTAGCTGCGGCTGTATATATAGCC

Reverse complement sequence

GGCTATATATACAGCCGCAGCTAACTGAGCAAAACACGGACGGCAAATATTCAAGGCAACATATCCTATACACACAGGCCCTCACGTATACACACGTGCA[C/T]
ACTAACTAAAAAATATCACCAAAAAATCTAGAAAAAATCATACACATACTTTCAATTGTATTACACATAGGGTTAAAATCTTAACGTCAAATTCATTATA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.90% 1.40% 4.13% 4.63% NA
All Indica  2759 87.50% 0.90% 3.84% 7.68% NA
All Japonica  1512 99.70% 0.00% 0.00% 0.26% NA
Aus  269 54.60% 13.40% 31.97% 0.00% NA
Indica I  595 94.50% 0.20% 0.67% 4.71% NA
Indica II  465 97.40% 0.20% 1.51% 0.86% NA
Indica III  913 85.10% 1.30% 5.37% 8.21% NA
Indica Intermediate  786 79.30% 1.50% 5.85% 13.36% NA
Temperate Japonica  767 99.50% 0.00% 0.00% 0.52% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 2.10% 2.08% 0.00% NA
Intermediate  90 95.60% 0.00% 1.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0627911377 G -> A LOC_Os06g46030.1 upstream_gene_variant ; 4742.0bp to feature; MODIFIER silent_mutation Average:43.476; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0627911377 G -> A LOC_Os06g46040.1 upstream_gene_variant ; 1784.0bp to feature; MODIFIER silent_mutation Average:43.476; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0627911377 G -> A LOC_Os06g46050.1 downstream_gene_variant ; 4081.0bp to feature; MODIFIER silent_mutation Average:43.476; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0627911377 G -> A LOC_Os06g46040-LOC_Os06g46050 intergenic_region ; MODIFIER silent_mutation Average:43.476; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0627911377 G -> DEL N N silent_mutation Average:43.476; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0627911377 NA 1.25E-07 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627911377 2.10E-06 2.09E-06 mr1366_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627911377 NA 5.80E-06 mr1442_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627911377 NA 3.90E-06 mr1442_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627911377 NA 1.95E-06 mr1469_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627911377 NA 2.95E-07 mr1533_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627911377 NA 1.98E-06 mr1661_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627911377 NA 1.28E-06 mr1721_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627911377 1.52E-06 1.52E-06 mr1967_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627911377 NA 5.34E-07 mr1980_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251