Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0627911377:

Variant ID: vg0627911377 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 27911377
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TATAATGAATTTGACGTTAAGATTTTAACCCTATGTGTAATACAATTGAAAGTATGTGTATGATTTTTTCTAGATTTTTTGGTGATATTTTTTAGTTAGT[G/A]
TGCACGTGTGTATACGTGAGGGCCTGTGTGTATAGGATATGTTGCCTTGAATATTTGCCGTCCGTGTTTTGCTCAGTTAGCTGCGGCTGTATATATAGCC

Reverse complement sequence

GGCTATATATACAGCCGCAGCTAACTGAGCAAAACACGGACGGCAAATATTCAAGGCAACATATCCTATACACACAGGCCCTCACGTATACACACGTGCA[C/T]
ACTAACTAAAAAATATCACCAAAAAATCTAGAAAAAATCATACACATACTTTCAATTGTATTACACATAGGGTTAAAATCTTAACGTCAAATTCATTATA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.90%	1.40%	4.13%	4.63%	NA
All Indica	2759	87.50%	0.90%	3.84%	7.68%	NA
All Japonica	1512	99.70%	0.00%	0.00%	0.26%	NA
Aus	269	54.60%	13.40%	31.97%	0.00%	NA
Indica I	595	94.50%	0.20%	0.67%	4.71%	NA
Indica II	465	97.40%	0.20%	1.51%	0.86%	NA
Indica III	913	85.10%	1.30%	5.37%	8.21%	NA
Indica Intermediate	786	79.30%	1.50%	5.85%	13.36%	NA
Temperate Japonica	767	99.50%	0.00%	0.00%	0.52%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	95.80%	2.10%	2.08%	0.00%	NA
Intermediate	90	95.60%	0.00%	1.11%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0627911377	G -> A	LOC_Os06g46030.1	upstream_gene_variant ; 4742.0bp to feature; MODIFIER	silent_mutation	Average:43.476; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N
vg0627911377	G -> A	LOC_Os06g46040.1	upstream_gene_variant ; 1784.0bp to feature; MODIFIER	silent_mutation	Average:43.476; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N
vg0627911377	G -> A	LOC_Os06g46050.1	downstream_gene_variant ; 4081.0bp to feature; MODIFIER	silent_mutation	Average:43.476; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N
vg0627911377	G -> A	LOC_Os06g46040-LOC_Os06g46050	intergenic_region ; MODIFIER	silent_mutation	Average:43.476; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N
vg0627911377	G -> DEL	N	N	silent_mutation	Average:43.476; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0627911377	NA	1.25E-07	mr1458	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627911377	2.10E-06	2.09E-06	mr1366_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627911377	NA	5.80E-06	mr1442_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627911377	NA	3.90E-06	mr1442_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627911377	NA	1.95E-06	mr1469_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627911377	NA	2.95E-07	mr1533_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627911377	NA	1.98E-06	mr1661_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627911377	NA	1.28E-06	mr1721_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627911377	1.52E-06	1.52E-06	mr1967_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627911377	NA	5.34E-07	mr1980_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251