\
| Variant ID: vg0627911377 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 27911377 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TATAATGAATTTGACGTTAAGATTTTAACCCTATGTGTAATACAATTGAAAGTATGTGTATGATTTTTTCTAGATTTTTTGGTGATATTTTTTAGTTAGT[G/A]
TGCACGTGTGTATACGTGAGGGCCTGTGTGTATAGGATATGTTGCCTTGAATATTTGCCGTCCGTGTTTTGCTCAGTTAGCTGCGGCTGTATATATAGCC
GGCTATATATACAGCCGCAGCTAACTGAGCAAAACACGGACGGCAAATATTCAAGGCAACATATCCTATACACACAGGCCCTCACGTATACACACGTGCA[C/T]
ACTAACTAAAAAATATCACCAAAAAATCTAGAAAAAATCATACACATACTTTCAATTGTATTACACATAGGGTTAAAATCTTAACGTCAAATTCATTATA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.90% | 1.40% | 4.13% | 4.63% | NA |
| All Indica | 2759 | 87.50% | 0.90% | 3.84% | 7.68% | NA |
| All Japonica | 1512 | 99.70% | 0.00% | 0.00% | 0.26% | NA |
| Aus | 269 | 54.60% | 13.40% | 31.97% | 0.00% | NA |
| Indica I | 595 | 94.50% | 0.20% | 0.67% | 4.71% | NA |
| Indica II | 465 | 97.40% | 0.20% | 1.51% | 0.86% | NA |
| Indica III | 913 | 85.10% | 1.30% | 5.37% | 8.21% | NA |
| Indica Intermediate | 786 | 79.30% | 1.50% | 5.85% | 13.36% | NA |
| Temperate Japonica | 767 | 99.50% | 0.00% | 0.00% | 0.52% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 2.10% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 0.00% | 1.11% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0627911377 | G -> A | LOC_Os06g46030.1 | upstream_gene_variant ; 4742.0bp to feature; MODIFIER | silent_mutation | Average:43.476; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| vg0627911377 | G -> A | LOC_Os06g46040.1 | upstream_gene_variant ; 1784.0bp to feature; MODIFIER | silent_mutation | Average:43.476; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| vg0627911377 | G -> A | LOC_Os06g46050.1 | downstream_gene_variant ; 4081.0bp to feature; MODIFIER | silent_mutation | Average:43.476; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| vg0627911377 | G -> A | LOC_Os06g46040-LOC_Os06g46050 | intergenic_region ; MODIFIER | silent_mutation | Average:43.476; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| vg0627911377 | G -> DEL | N | N | silent_mutation | Average:43.476; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0627911377 | NA | 1.25E-07 | mr1458 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627911377 | 2.10E-06 | 2.09E-06 | mr1366_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627911377 | NA | 5.80E-06 | mr1442_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627911377 | NA | 3.90E-06 | mr1442_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627911377 | NA | 1.95E-06 | mr1469_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627911377 | NA | 2.95E-07 | mr1533_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627911377 | NA | 1.98E-06 | mr1661_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627911377 | NA | 1.28E-06 | mr1721_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627911377 | 1.52E-06 | 1.52E-06 | mr1967_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627911377 | NA | 5.34E-07 | mr1980_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |