\
| Variant ID: vg0627796033 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 27796033 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TGCTCTTTTGTAGAATTTGAGACAAAGGAGGCTTGTGAGCGGGCATTCTTCAAGGTTAGTTGCCTAAAATCCTGTTTCATGTGGCAGATAAAACTTGGTT[C/A]
TTGTAATTGTACTTTATTTCCCTTCATTACTTAGCATTTCTTTGCTAGCATATTTTTATAAGTCATTTTTGCTTGACTAGTGAATGTTACTTGATTGTTT
AAACAATCAAGTAACATTCACTAGTCAAGCAAAAATGACTTATAAAAATATGCTAGCAAAGAAATGCTAAGTAATGAAGGGAAATAAAGTACAATTACAA[G/T]
AACCAAGTTTTATCTGCCACATGAAACAGGATTTTAGGCAACTAACCTTGAAGAATGCCCGCTCACAAGCCTCCTTTGTCTCAAATTCTACAAAAGAGCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.50% | 1.80% | 1.67% | 0.00% | NA |
| All Indica | 2759 | 99.50% | 0.00% | 0.54% | 0.00% | NA |
| All Japonica | 1512 | 90.10% | 5.80% | 4.17% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.30% | 0.00% | 1.68% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.00% | 0.65% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.00% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 81.70% | 11.20% | 7.04% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.00% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.70% | 0.40% | 2.90% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 0.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0627796033 | C -> A | LOC_Os06g45920.1 | upstream_gene_variant ; 4875.0bp to feature; MODIFIER | silent_mutation | Average:34.958; most accessible tissue: Callus, score: 85.025 | N | N | N | N |
| vg0627796033 | C -> A | LOC_Os06g45910.1 | intron_variant ; MODIFIER | silent_mutation | Average:34.958; most accessible tissue: Callus, score: 85.025 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0627796033 | NA | 1.82E-06 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627796033 | NA | 9.29E-06 | mr1280 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627796033 | NA | 2.66E-06 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627796033 | NA | 7.34E-06 | mr1315 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627796033 | NA | 5.64E-06 | mr1358 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627796033 | NA | 2.02E-06 | mr1379 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627796033 | NA | 1.37E-06 | mr1515 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627796033 | NA | 8.82E-08 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627796033 | NA | 4.81E-07 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627796033 | 4.46E-06 | 4.46E-06 | mr1687 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627796033 | NA | 3.61E-06 | mr1765 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627796033 | NA | 8.44E-06 | mr1788 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627796033 | NA | 2.23E-07 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627796033 | NA | 3.47E-08 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627796033 | NA | 6.41E-06 | mr1765_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |