\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0627796033:

Variant ID: vg0627796033 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 27796033
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGCTCTTTTGTAGAATTTGAGACAAAGGAGGCTTGTGAGCGGGCATTCTTCAAGGTTAGTTGCCTAAAATCCTGTTTCATGTGGCAGATAAAACTTGGTT[C/A]
TTGTAATTGTACTTTATTTCCCTTCATTACTTAGCATTTCTTTGCTAGCATATTTTTATAAGTCATTTTTGCTTGACTAGTGAATGTTACTTGATTGTTT

Reverse complement sequence

AAACAATCAAGTAACATTCACTAGTCAAGCAAAAATGACTTATAAAAATATGCTAGCAAAGAAATGCTAAGTAATGAAGGGAAATAAAGTACAATTACAA[G/T]
AACCAAGTTTTATCTGCCACATGAAACAGGATTTTAGGCAACTAACCTTGAAGAATGCCCGCTCACAAGCCTCCTTTGTCTCAAATTCTACAAAAGAGCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.50% 1.80% 1.67% 0.00% NA
All Indica  2759 99.50% 0.00% 0.54% 0.00% NA
All Japonica  1512 90.10% 5.80% 4.17% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.30% 0.00% 1.68% 0.00% NA
Indica II  465 99.40% 0.00% 0.65% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.00% 0.25% 0.00% NA
Temperate Japonica  767 81.70% 11.20% 7.04% 0.00% NA
Tropical Japonica  504 99.60% 0.00% 0.40% 0.00% NA
Japonica Intermediate  241 96.70% 0.40% 2.90% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 0.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0627796033 C -> A LOC_Os06g45920.1 upstream_gene_variant ; 4875.0bp to feature; MODIFIER silent_mutation Average:34.958; most accessible tissue: Callus, score: 85.025 N N N N
vg0627796033 C -> A LOC_Os06g45910.1 intron_variant ; MODIFIER silent_mutation Average:34.958; most accessible tissue: Callus, score: 85.025 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0627796033 NA 1.82E-06 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627796033 NA 9.29E-06 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627796033 NA 2.66E-06 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627796033 NA 7.34E-06 mr1315 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627796033 NA 5.64E-06 mr1358 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627796033 NA 2.02E-06 mr1379 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627796033 NA 1.37E-06 mr1515 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627796033 NA 8.82E-08 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627796033 NA 4.81E-07 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627796033 4.46E-06 4.46E-06 mr1687 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627796033 NA 3.61E-06 mr1765 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627796033 NA 8.44E-06 mr1788 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627796033 NA 2.23E-07 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627796033 NA 3.47E-08 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627796033 NA 6.41E-06 mr1765_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251