\
| Variant ID: vg0627481470 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr06 | Position: 27481470 |
| Reference Allele: GC | Alternative Allele: G,AC |
| Primary Allele: GC | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
CCACACGCGCGGGTCCATGTCGTCCGCTGCCGAGGCGGACGACGTCGACGACGGCAGAGGCGGCAGCCGGCGAGGGTTCATCATGGTCGTCGTCGTCGGC[GC/G,AC]
GCGGCGTCGTCAGCTGCAGCTGCGTGAGCTGAAAATTTTCAAGGGTGAAGTGGAGTGGAGTGAGGCAGCTGTGAAGCGGCAGCTGCGATCAAATGATAGT
ACTATCATTTGATCGCAGCTGCCGCTTCACAGCTGCCTCACTCCACTCCACTTCACCCTTGAAAATTTTCAGCTCACGCAGCTGCAGCTGACGACGCCGC[GC/C,GT]
GCCGACGACGACGACCATGATGAACCCTCGCCGGCTGCCGCCTCTGCCGTCGTCGACGTCGTCCGCCTCGGCAGCGGACGACATGGACCCGCGCGTGTGG
| Populations | Population Size | Frequency of GC(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.50% | 9.00% | 0.53% | 0.00% | AC: 0.99% |
| All Indica | 2759 | 92.00% | 7.90% | 0.00% | 0.00% | AC: 0.04% |
| All Japonica | 1512 | 95.60% | 0.20% | 1.32% | 0.00% | AC: 2.84% |
| Aus | 269 | 29.40% | 69.90% | 0.74% | 0.00% | NA |
| Indica I | 595 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 84.10% | 15.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 92.90% | 7.00% | 0.00% | 0.00% | AC: 0.13% |
| Temperate Japonica | 767 | 99.20% | 0.00% | 0.65% | 0.00% | AC: 0.13% |
| Tropical Japonica | 504 | 89.10% | 0.20% | 2.38% | 0.00% | AC: 8.33% |
| Japonica Intermediate | 241 | 97.90% | 0.80% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 92.70% | 4.20% | 2.08% | 0.00% | AC: 1.04% |
| Intermediate | 90 | 86.70% | 10.00% | 1.11% | 0.00% | AC: 2.22% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0627481470 | GC -> G | LOC_Os06g45460.1 | upstream_gene_variant ; 84.0bp to feature; MODIFIER | silent_mutation | Average:73.022; most accessible tissue: Zhenshan97 flower, score: 80.904 | N | N | N | N |
| vg0627481470 | GC -> G | LOC_Os06g45460-LOC_Os06g45470 | intergenic_region ; MODIFIER | silent_mutation | Average:73.022; most accessible tissue: Zhenshan97 flower, score: 80.904 | N | N | N | N |
| vg0627481470 | GC -> AC | LOC_Os06g45460.1 | upstream_gene_variant ; 83.0bp to feature; MODIFIER | silent_mutation | Average:73.022; most accessible tissue: Zhenshan97 flower, score: 80.904 | N | N | N | N |
| vg0627481470 | GC -> AC | LOC_Os06g45460-LOC_Os06g45470 | intergenic_region ; MODIFIER | silent_mutation | Average:73.022; most accessible tissue: Zhenshan97 flower, score: 80.904 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0627481470 | NA | 6.36E-07 | mr1076 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627481470 | NA | 2.45E-08 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627481470 | NA | 1.16E-09 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627481470 | NA | 4.63E-06 | mr1107 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627481470 | 2.30E-06 | 2.30E-06 | mr1145 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627481470 | 9.66E-06 | 9.65E-06 | mr1204 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627481470 | NA | 3.09E-07 | mr1226 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627481470 | NA | 3.42E-06 | mr1082_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627481470 | NA | 1.01E-06 | mr1104_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627481470 | NA | 1.74E-07 | mr1226_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |