\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0627481470:

Variant ID: vg0627481470 (JBrowse)Variation Type: INDEL
Chromosome: chr06Position: 27481470
Reference Allele: GCAlternative Allele: G,AC
Primary Allele: GCSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCACACGCGCGGGTCCATGTCGTCCGCTGCCGAGGCGGACGACGTCGACGACGGCAGAGGCGGCAGCCGGCGAGGGTTCATCATGGTCGTCGTCGTCGGC[GC/G,AC]
GCGGCGTCGTCAGCTGCAGCTGCGTGAGCTGAAAATTTTCAAGGGTGAAGTGGAGTGGAGTGAGGCAGCTGTGAAGCGGCAGCTGCGATCAAATGATAGT

Reverse complement sequence

ACTATCATTTGATCGCAGCTGCCGCTTCACAGCTGCCTCACTCCACTCCACTTCACCCTTGAAAATTTTCAGCTCACGCAGCTGCAGCTGACGACGCCGC[GC/C,GT]
GCCGACGACGACGACCATGATGAACCCTCGCCGGCTGCCGCCTCTGCCGTCGTCGACGTCGTCCGCCTCGGCAGCGGACGACATGGACCCGCGCGTGTGG

Allele Frequencies:

Populations Population SizeFrequency of GC(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.50% 9.00% 0.53% 0.00% AC: 0.99%
All Indica  2759 92.00% 7.90% 0.00% 0.00% AC: 0.04%
All Japonica  1512 95.60% 0.20% 1.32% 0.00% AC: 2.84%
Aus  269 29.40% 69.90% 0.74% 0.00% NA
Indica I  595 98.30% 1.70% 0.00% 0.00% NA
Indica II  465 98.10% 1.90% 0.00% 0.00% NA
Indica III  913 84.10% 15.90% 0.00% 0.00% NA
Indica Intermediate  786 92.90% 7.00% 0.00% 0.00% AC: 0.13%
Temperate Japonica  767 99.20% 0.00% 0.65% 0.00% AC: 0.13%
Tropical Japonica  504 89.10% 0.20% 2.38% 0.00% AC: 8.33%
Japonica Intermediate  241 97.90% 0.80% 1.24% 0.00% NA
VI/Aromatic  96 92.70% 4.20% 2.08% 0.00% AC: 1.04%
Intermediate  90 86.70% 10.00% 1.11% 0.00% AC: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0627481470 GC -> G LOC_Os06g45460.1 upstream_gene_variant ; 84.0bp to feature; MODIFIER silent_mutation Average:73.022; most accessible tissue: Zhenshan97 flower, score: 80.904 N N N N
vg0627481470 GC -> G LOC_Os06g45460-LOC_Os06g45470 intergenic_region ; MODIFIER silent_mutation Average:73.022; most accessible tissue: Zhenshan97 flower, score: 80.904 N N N N
vg0627481470 GC -> AC LOC_Os06g45460.1 upstream_gene_variant ; 83.0bp to feature; MODIFIER silent_mutation Average:73.022; most accessible tissue: Zhenshan97 flower, score: 80.904 N N N N
vg0627481470 GC -> AC LOC_Os06g45460-LOC_Os06g45470 intergenic_region ; MODIFIER silent_mutation Average:73.022; most accessible tissue: Zhenshan97 flower, score: 80.904 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0627481470 NA 6.36E-07 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627481470 NA 2.45E-08 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627481470 NA 1.16E-09 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627481470 NA 4.63E-06 mr1107 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627481470 2.30E-06 2.30E-06 mr1145 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627481470 9.66E-06 9.65E-06 mr1204 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627481470 NA 3.09E-07 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627481470 NA 3.42E-06 mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627481470 NA 1.01E-06 mr1104_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627481470 NA 1.74E-07 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251