Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0627350084:

Variant ID: vg0627350084 (JBrowse)Variation Type: INDEL
Chromosome: chr06Position: 27350084
Reference Allele: GAlternative Allele: GTATAGA,A,GTATAGATATAGA
Primary Allele: GTATAGASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCGCGAAAAAAAAACGGACAGAAAAAAACCGCCGTGCGCGTGTGGGAAATCGGCGACGGACCAAAAATAATGACGGAAGCCTTAAGAATTTTTTTATTAG[G/GTATAGA,A,GTATAGATATAGA]
TATAGATTTGACAAATTTCCTTTCCTACATGTGTCGGTCAGTGTATTTCCCTGCATGGTTTCCTATCAAAAAAAGACCAAGAAAACAGGTGTTTGGTTGT

Reverse complement sequence

ACAACCAAACACCTGTTTTCTTGGTCTTTTTTTGATAGGAAACCATGCAGGGAAATACACTGACCGACACATGTAGGAAAGGAAATTTGTCAAATCTATA[C/TCTATAC,T,TCTATATCTATAC]
CTAATAAAAAAATTCTTAAGGCTTCCGTCATTATTTTTGGTCCGTCGCCGATTTCCCACACGCGCACGGCGGTTTTTTTCTGTCCGTTTTTTTTTCGCGC

Allele Frequencies:

Populations Population SizeFrequency of GTATAGA(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.40% 40.20% 0.30% 0.00% A: 1.97%; GTATAGATATAGA: 0.06%
All Indica  2759 91.10% 6.70% 0.25% 0.00% A: 1.92%; GTATAGATATAGA: 0.04%
All Japonica  1512 0.90% 99.00% 0.00% 0.00% GTATAGATATAGA: 0.07%
Aus  269 52.40% 31.20% 2.23% 0.00% A: 13.75%; GTATAGATATAGA: 0.37%
Indica I  595 97.80% 1.30% 0.50% 0.00% A: 0.34%
Indica II  465 96.10% 2.20% 0.00% 0.00% A: 1.72%
Indica III  913 81.80% 14.70% 0.11% 0.00% A: 3.29%; GTATAGATATAGA: 0.11%
Indica Intermediate  786 93.80% 4.20% 0.38% 0.00% A: 1.65%
Temperate Japonica  767 1.40% 98.60% 0.00% 0.00% NA
Tropical Japonica  504 0.00% 99.80% 0.00% 0.00% GTATAGATATAGA: 0.20%
Japonica Intermediate  241 1.20% 98.80% 0.00% 0.00% NA
VI/Aromatic  96 7.30% 92.70% 0.00% 0.00% NA
Intermediate  90 43.30% 52.20% 1.11% 0.00% A: 3.33%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0627350084 G -> GTATAGATATAGA LOC_Os06g45250.1 upstream_gene_variant ; 4296.0bp to feature; MODIFIER silent_mutation Average:93.372; most accessible tissue: Minghui63 young leaf, score: 97.522 N N N N
vg0627350084 G -> GTATAGATATAGA LOC_Os06g45260.1 upstream_gene_variant ; 1907.0bp to feature; MODIFIER silent_mutation Average:93.372; most accessible tissue: Minghui63 young leaf, score: 97.522 N N N N
vg0627350084 G -> GTATAGATATAGA LOC_Os06g45250-LOC_Os06g45260 intergenic_region ; MODIFIER silent_mutation Average:93.372; most accessible tissue: Minghui63 young leaf, score: 97.522 N N N N
vg0627350084 G -> A LOC_Os06g45250.1 upstream_gene_variant ; 4295.0bp to feature; MODIFIER silent_mutation Average:93.372; most accessible tissue: Minghui63 young leaf, score: 97.522 N N N N
vg0627350084 G -> A LOC_Os06g45260.1 upstream_gene_variant ; 1908.0bp to feature; MODIFIER silent_mutation Average:93.372; most accessible tissue: Minghui63 young leaf, score: 97.522 N N N N
vg0627350084 G -> A LOC_Os06g45250-LOC_Os06g45260 intergenic_region ; MODIFIER silent_mutation Average:93.372; most accessible tissue: Minghui63 young leaf, score: 97.522 N N N N
vg0627350084 G -> GTATAGA LOC_Os06g45250.1 upstream_gene_variant ; 4296.0bp to feature; MODIFIER silent_mutation Average:93.372; most accessible tissue: Minghui63 young leaf, score: 97.522 N N N N
vg0627350084 G -> GTATAGA LOC_Os06g45260.1 upstream_gene_variant ; 1907.0bp to feature; MODIFIER silent_mutation Average:93.372; most accessible tissue: Minghui63 young leaf, score: 97.522 N N N N
vg0627350084 G -> GTATAGA LOC_Os06g45250-LOC_Os06g45260 intergenic_region ; MODIFIER silent_mutation Average:93.372; most accessible tissue: Minghui63 young leaf, score: 97.522 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0627350084 G A -0.04 -0.02 -0.01 -0.03 -0.02 -0.01
vg0627350084 G GTATA* -0.01 0.21 0.26 0.1 0.15 0.14

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0627350084 4.34E-06 NA mr1113 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251