\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0627335333:

Variant ID: vg0627335333 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 27335333
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCATCGCCGTCTGGTTAACCTTCCCTAGTATTATACATTTTTTATCCAAATGATCAAAATACTCCTGGAACAAAAACATCCAAAATTTGGACAAAAATTT[C/T]
GAAATATCAATATTATAAACATAAGATTGTAAACATCCAATTTTTGTCAAAAACTTAAAATATGATAATTCAGAATTTTTTTATCAAACTTTAGAAGTTT

Reverse complement sequence

AAACTTCTAAAGTTTGATAAAAAAATTCTGAATTATCATATTTTAAGTTTTTGACAAAAATTGGATGTTTACAATCTTATGTTTATAATATTGATATTTC[G/A]
AAATTTTTGTCCAAATTTTGGATGTTTTTGTTCCAGGAGTATTTTGATCATTTGGATAAAAAATGTATAATACTAGGGAAGGTTAACCAGACGGCGATGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.30% 8.40% 0.32% 0.00% NA
All Indica  2759 94.80% 5.10% 0.07% 0.00% NA
All Japonica  1512 92.10% 7.10% 0.79% 0.00% NA
Aus  269 48.00% 52.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 97.40% 2.60% 0.00% 0.00% NA
Indica III  913 89.90% 10.00% 0.11% 0.00% NA
Indica Intermediate  786 95.00% 4.80% 0.13% 0.00% NA
Temperate Japonica  767 98.40% 1.30% 0.26% 0.00% NA
Tropical Japonica  504 84.50% 13.90% 1.59% 0.00% NA
Japonica Intermediate  241 88.00% 11.20% 0.83% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 93.30% 5.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0627335333 C -> T LOC_Os06g45210.1 upstream_gene_variant ; 4977.0bp to feature; MODIFIER silent_mutation Average:39.514; most accessible tissue: Zhenshan97 root, score: 51.776 N N N N
vg0627335333 C -> T LOC_Os06g45230.1 upstream_gene_variant ; 1266.0bp to feature; MODIFIER silent_mutation Average:39.514; most accessible tissue: Zhenshan97 root, score: 51.776 N N N N
vg0627335333 C -> T LOC_Os06g45220.1 downstream_gene_variant ; 2485.0bp to feature; MODIFIER silent_mutation Average:39.514; most accessible tissue: Zhenshan97 root, score: 51.776 N N N N
vg0627335333 C -> T LOC_Os06g45240.1 downstream_gene_variant ; 514.0bp to feature; MODIFIER silent_mutation Average:39.514; most accessible tissue: Zhenshan97 root, score: 51.776 N N N N
vg0627335333 C -> T LOC_Os06g45230-LOC_Os06g45240 intergenic_region ; MODIFIER silent_mutation Average:39.514; most accessible tissue: Zhenshan97 root, score: 51.776 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0627335333 4.18E-07 4.17E-07 mr1978 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251