\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0627297348:

Variant ID: vg0627297348 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 27297348
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 345. )

Flanking Sequence (100 bp) in Reference Genome:


TTCTGACCTACTCTTTGGGCAAGAAACTGCGTAGTGTTCATATACAGCGTTAGCTAGGCTTGCCAAATAACAGAAGGTATGTTACTTACAAAATGGACCA[T/C]
TAGATTGTAGTGGACCAGAACAAATTCTGTGGCAAGGTGACATGTGTGAGCAATGCCATATCATTTTTTCTAAAGAAGAGAATAATGTCACTGTGCCCTT

Reverse complement sequence

AAGGGCACAGTGACATTATTCTCTTCTTTAGAAAAAATGATATGGCATTGCTCACACATGTCACCTTGCCACAGAATTTGTTCTGGTCCACTACAATCTA[A/G]
TGGTCCATTTTGTAAGTAACATACCTTCTGTTATTTGGCAAGCCTAGCTAACGCTGTATATGAACACTACGCAGTTTCTTGCCCAAAGAGTAGGTCAGAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.20% 5.80% 3.05% 0.00% NA
All Indica  2759 85.40% 9.60% 5.04% 0.00% NA
All Japonica  1512 99.80% 0.00% 0.20% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 86.60% 2.40% 11.09% 0.00% NA
Indica II  465 52.30% 38.30% 9.46% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 87.30% 9.00% 3.69% 0.00% NA
Temperate Japonica  767 99.60% 0.00% 0.39% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 90.00% 7.80% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0627297348 T -> C LOC_Os06g45120.1 upstream_gene_variant ; 4496.0bp to feature; MODIFIER silent_mutation Average:66.385; most accessible tissue: Minghui63 flag leaf, score: 79.962 N N N N
vg0627297348 T -> C LOC_Os06g45120.2 upstream_gene_variant ; 4496.0bp to feature; MODIFIER silent_mutation Average:66.385; most accessible tissue: Minghui63 flag leaf, score: 79.962 N N N N
vg0627297348 T -> C LOC_Os06g45130.1 downstream_gene_variant ; 2294.0bp to feature; MODIFIER silent_mutation Average:66.385; most accessible tissue: Minghui63 flag leaf, score: 79.962 N N N N
vg0627297348 T -> C LOC_Os06g45140.1 downstream_gene_variant ; 2566.0bp to feature; MODIFIER silent_mutation Average:66.385; most accessible tissue: Minghui63 flag leaf, score: 79.962 N N N N
vg0627297348 T -> C LOC_Os06g45140.2 downstream_gene_variant ; 2566.0bp to feature; MODIFIER silent_mutation Average:66.385; most accessible tissue: Minghui63 flag leaf, score: 79.962 N N N N
vg0627297348 T -> C LOC_Os06g45140.3 downstream_gene_variant ; 2566.0bp to feature; MODIFIER silent_mutation Average:66.385; most accessible tissue: Minghui63 flag leaf, score: 79.962 N N N N
vg0627297348 T -> C LOC_Os06g45130-LOC_Os06g45140 intergenic_region ; MODIFIER silent_mutation Average:66.385; most accessible tissue: Minghui63 flag leaf, score: 79.962 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0627297348 NA 1.01E-08 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627297348 NA 2.37E-06 mr1598 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627297348 NA 4.64E-06 mr1887 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627297348 NA 4.08E-08 mr1944 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627297348 NA 1.15E-06 mr1188_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627297348 NA 2.34E-08 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627297348 NA 7.41E-06 mr1449_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627297348 NA 1.69E-06 mr1899_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627297348 NA 5.19E-06 mr1928_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627297348 NA 7.62E-08 mr1928_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627297348 NA 5.40E-08 mr1931_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627297348 NA 9.63E-10 mr1931_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251