\
| Variant ID: vg0627297348 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 27297348 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 345. )
TTCTGACCTACTCTTTGGGCAAGAAACTGCGTAGTGTTCATATACAGCGTTAGCTAGGCTTGCCAAATAACAGAAGGTATGTTACTTACAAAATGGACCA[T/C]
TAGATTGTAGTGGACCAGAACAAATTCTGTGGCAAGGTGACATGTGTGAGCAATGCCATATCATTTTTTCTAAAGAAGAGAATAATGTCACTGTGCCCTT
AAGGGCACAGTGACATTATTCTCTTCTTTAGAAAAAATGATATGGCATTGCTCACACATGTCACCTTGCCACAGAATTTGTTCTGGTCCACTACAATCTA[A/G]
TGGTCCATTTTGTAAGTAACATACCTTCTGTTATTTGGCAAGCCTAGCTAACGCTGTATATGAACACTACGCAGTTTCTTGCCCAAAGAGTAGGTCAGAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.20% | 5.80% | 3.05% | 0.00% | NA |
| All Indica | 2759 | 85.40% | 9.60% | 5.04% | 0.00% | NA |
| All Japonica | 1512 | 99.80% | 0.00% | 0.20% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 86.60% | 2.40% | 11.09% | 0.00% | NA |
| Indica II | 465 | 52.30% | 38.30% | 9.46% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 87.30% | 9.00% | 3.69% | 0.00% | NA |
| Temperate Japonica | 767 | 99.60% | 0.00% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 7.80% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0627297348 | T -> C | LOC_Os06g45120.1 | upstream_gene_variant ; 4496.0bp to feature; MODIFIER | silent_mutation | Average:66.385; most accessible tissue: Minghui63 flag leaf, score: 79.962 | N | N | N | N |
| vg0627297348 | T -> C | LOC_Os06g45120.2 | upstream_gene_variant ; 4496.0bp to feature; MODIFIER | silent_mutation | Average:66.385; most accessible tissue: Minghui63 flag leaf, score: 79.962 | N | N | N | N |
| vg0627297348 | T -> C | LOC_Os06g45130.1 | downstream_gene_variant ; 2294.0bp to feature; MODIFIER | silent_mutation | Average:66.385; most accessible tissue: Minghui63 flag leaf, score: 79.962 | N | N | N | N |
| vg0627297348 | T -> C | LOC_Os06g45140.1 | downstream_gene_variant ; 2566.0bp to feature; MODIFIER | silent_mutation | Average:66.385; most accessible tissue: Minghui63 flag leaf, score: 79.962 | N | N | N | N |
| vg0627297348 | T -> C | LOC_Os06g45140.2 | downstream_gene_variant ; 2566.0bp to feature; MODIFIER | silent_mutation | Average:66.385; most accessible tissue: Minghui63 flag leaf, score: 79.962 | N | N | N | N |
| vg0627297348 | T -> C | LOC_Os06g45140.3 | downstream_gene_variant ; 2566.0bp to feature; MODIFIER | silent_mutation | Average:66.385; most accessible tissue: Minghui63 flag leaf, score: 79.962 | N | N | N | N |
| vg0627297348 | T -> C | LOC_Os06g45130-LOC_Os06g45140 | intergenic_region ; MODIFIER | silent_mutation | Average:66.385; most accessible tissue: Minghui63 flag leaf, score: 79.962 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0627297348 | NA | 1.01E-08 | mr1557 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627297348 | NA | 2.37E-06 | mr1598 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627297348 | NA | 4.64E-06 | mr1887 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627297348 | NA | 4.08E-08 | mr1944 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627297348 | NA | 1.15E-06 | mr1188_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627297348 | NA | 2.34E-08 | mr1449_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627297348 | NA | 7.41E-06 | mr1449_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627297348 | NA | 1.69E-06 | mr1899_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627297348 | NA | 5.19E-06 | mr1928_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627297348 | NA | 7.62E-08 | mr1928_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627297348 | NA | 5.40E-08 | mr1931_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627297348 | NA | 9.63E-10 | mr1931_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |