Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0627259502:

Variant ID: vg0627259502 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 27259502
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATTGAAGAATCCTTCCCAATCTTGACTTCAGTAGGTTCATTACTTCTACATAAAACGAAATAGTTTTATCGGACGCGGAAAGAAGCACGAATATCCTGA[T/C]
ATACCAAACATTCCTAATTAGTACCCGTTGTCAAAATCACATTTACGTGATAATGGCCTACGGTTTTCTTTACTTTTTTCTTGGCTATTTGCCTATTCCT

Reverse complement sequence

AGGAATAGGCAAATAGCCAAGAAAAAAGTAAAGAAAACCGTAGGCCATTATCACGTAAATGTGATTTTGACAACGGGTACTAATTAGGAATGTTTGGTAT[A/G]
TCAGGATATTCGTGCTTCTTTCCGCGTCCGATAAAACTATTTCGTTTTATGTAGAAGTAATGAACCTACTGAAGTCAAGATTGGGAAGGATTCTTCAATT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 98.30% 1.50% 0.15% 0.00% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 94.80% 4.70% 0.46% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 91.90% 7.20% 0.91% 0.00% NA
Tropical Japonica  504 98.20% 1.80% 0.00% 0.00% NA
Japonica Intermediate  241 97.10% 2.90% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0627259502 T -> C LOC_Os06g45070.1 upstream_gene_variant ; 3310.0bp to feature; MODIFIER silent_mutation Average:64.206; most accessible tissue: Callus, score: 86.71 N N N N
vg0627259502 T -> C LOC_Os06g45070.2 upstream_gene_variant ; 3303.0bp to feature; MODIFIER silent_mutation Average:64.206; most accessible tissue: Callus, score: 86.71 N N N N
vg0627259502 T -> C LOC_Os06g45040.1 downstream_gene_variant ; 4463.0bp to feature; MODIFIER silent_mutation Average:64.206; most accessible tissue: Callus, score: 86.71 N N N N
vg0627259502 T -> C LOC_Os06g45060.1 downstream_gene_variant ; 1792.0bp to feature; MODIFIER silent_mutation Average:64.206; most accessible tissue: Callus, score: 86.71 N N N N
vg0627259502 T -> C LOC_Os06g45050.1 intron_variant ; MODIFIER silent_mutation Average:64.206; most accessible tissue: Callus, score: 86.71 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0627259502 1.49E-06 1.49E-06 mr1004_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627259502 1.22E-06 1.22E-06 mr1973_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251