\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0627157824:

Variant ID: vg0627157824 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 27157824
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.64, A: 0.36, others allele: 0.00, population size: 73. )

Flanking Sequence (100 bp) in Reference Genome:


ATCGGATCCCCCGCCTCCCCCTATACACAGTCCTCCCACTTCTTCCCTTACTACAGTAAACCACAAAAAAAATTTAAAAAAAACAAAAAGTTAGAAAAAA[A/T]
TTATGTATAGAAATACTATATATAAAAAATTTGAAATCAAATTCAAATTTGAATTCAATTTGATTTTGATTTTTCAAATTCAAATTCAAATTTGAATTCA

Reverse complement sequence

TGAATTCAAATTTGAATTTGAATTTGAAAAATCAAAATCAAATTGAATTCAAATTTGAATTTGATTTCAAATTTTTTATATATAGTATTTCTATACATAA[T/A]
TTTTTTCTAACTTTTTGTTTTTTTTAAATTTTTTTTGTGGTTTACTGTAGTAAGGGAAGAAGTGGGAGGACTGTGTATAGGGGGAGGCGGGGGATCCGAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.10% 42.20% 0.21% 0.47% NA
All Indica  2759 86.70% 12.40% 0.22% 0.72% NA
All Japonica  1512 6.20% 93.80% 0.00% 0.00% NA
Aus  269 61.30% 37.90% 0.00% 0.74% NA
Indica I  595 98.80% 0.80% 0.34% 0.00% NA
Indica II  465 78.30% 21.50% 0.22% 0.00% NA
Indica III  913 82.10% 15.60% 0.11% 2.19% NA
Indica Intermediate  786 87.80% 12.00% 0.25% 0.00% NA
Temperate Japonica  767 0.90% 99.10% 0.00% 0.00% NA
Tropical Japonica  504 16.10% 83.90% 0.00% 0.00% NA
Japonica Intermediate  241 2.50% 97.50% 0.00% 0.00% NA
VI/Aromatic  96 5.20% 94.80% 0.00% 0.00% NA
Intermediate  90 46.70% 48.90% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0627157824 A -> T LOC_Os06g44910.1 downstream_gene_variant ; 3738.0bp to feature; MODIFIER silent_mutation Average:65.704; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N
vg0627157824 A -> T LOC_Os06g44920.1 downstream_gene_variant ; 1564.0bp to feature; MODIFIER silent_mutation Average:65.704; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N
vg0627157824 A -> T LOC_Os06g44930.1 downstream_gene_variant ; 4442.0bp to feature; MODIFIER silent_mutation Average:65.704; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N
vg0627157824 A -> T LOC_Os06g44910.2 downstream_gene_variant ; 3738.0bp to feature; MODIFIER silent_mutation Average:65.704; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N
vg0627157824 A -> T LOC_Os06g44920-LOC_Os06g44930 intergenic_region ; MODIFIER silent_mutation Average:65.704; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N
vg0627157824 A -> DEL N N silent_mutation Average:65.704; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0627157824 NA 2.07E-14 mr1218 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627157824 3.48E-06 3.48E-06 mr1065_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627157824 1.29E-09 3.06E-10 mr1068_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627157824 NA 1.60E-06 mr1072_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627157824 NA 1.63E-06 mr1075_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627157824 NA 1.98E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627157824 7.69E-06 2.73E-06 mr1078_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627157824 3.99E-06 NA mr1085_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627157824 1.25E-09 1.45E-10 mr1090_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627157824 NA 9.92E-06 mr1091_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627157824 1.48E-07 3.31E-08 mr1094_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627157824 4.36E-07 2.77E-09 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627157824 2.04E-06 2.03E-06 mr1108_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627157824 5.89E-06 1.21E-06 mr1110_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627157824 8.93E-07 6.92E-08 mr1112_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627157824 1.00E-07 1.28E-09 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627157824 8.53E-06 1.66E-06 mr1155_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627157824 1.52E-10 3.73E-11 mr1200_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627157824 NA 3.17E-07 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627157824 2.71E-08 2.71E-08 mr1234_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627157824 1.83E-06 NA mr1241_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627157824 NA 8.15E-07 mr1243_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627157824 4.45E-06 3.28E-07 mr1246_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627157824 5.23E-06 4.96E-07 mr1255_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627157824 NA 6.87E-17 mr1592_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627157824 NA 8.21E-06 mr1620_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627157824 NA 2.59E-14 mr1790_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627157824 NA 1.65E-06 mr1798_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251