Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0627151716:

Variant ID: vg0627151716 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 27151716
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.72, C: 0.27, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:

CGGCGCTCATCGCCCTCGCGGCGCTCGGATCCGCCGCCTCGGGGACGGCGTCCAAGTCGTCCTTCGTGAAATCCACCGTCAAAGCCCACGACGTCGTCAT[A/C]
TTCTCCAAGTCATACTGCCCGTACGGCCCCCCCTCTCCCATCTATCCTCTGTGCATTCCGCTTTACTGCTCTCGCTTAGCTTTTGCTGAGAATTTCGATT

Reverse complement sequence

AATCGAAATTCTCAGCAAAAGCTAAGCGAGAGCAGTAAAGCGGAATGCACAGAGGATAGATGGGAGAGGGGGGGCCGTACGGGCAGTATGACTTGGAGAA[T/G]
ATGACGACGTCGTGGGCTTTGACGGTGGATTTCACGAAGGACGACTTGGACGCCGTCCCCGAGGCGGCGGATCCGAGCGCCGCGAGGGCGATGAGCGCCG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.10%	40.60%	0.11%	0.15%	NA
All Indica	2759	35.00%	64.60%	0.18%	0.25%	NA
All Japonica	1512	94.10%	5.90%	0.00%	0.00%	NA
Aus	269	94.40%	5.60%	0.00%	0.00%	NA
Indica I	595	6.40%	93.40%	0.17%	0.00%	NA
Indica II	465	31.40%	68.00%	0.22%	0.43%	NA
Indica III	913	51.30%	48.30%	0.22%	0.22%	NA
Indica Intermediate	786	39.90%	59.50%	0.13%	0.38%	NA
Temperate Japonica	767	99.60%	0.40%	0.00%	0.00%	NA
Tropical Japonica	504	83.90%	16.10%	0.00%	0.00%	NA
Japonica Intermediate	241	97.90%	2.10%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	62.20%	37.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0627151716	A -> C	LOC_Os06g44910.1	synonymous_variant ; p.Ile47Ile; LOW	synonymous_codon	Average:89.853; most accessible tissue: Zhenshan97 panicle, score: 92.66	N	N	N	N
vg0627151716	A -> C	LOC_Os06g44910.2	synonymous_variant ; p.Ile47Ile; LOW	synonymous_codon	Average:89.853; most accessible tissue: Zhenshan97 panicle, score: 92.66	N	N	N	N
vg0627151716	A -> DEL	LOC_Os06g44910.2	N	frameshift_variant	Average:89.853; most accessible tissue: Zhenshan97 panicle, score: 92.66	N	N	N	N
vg0627151716	A -> DEL	LOC_Os06g44910.1	N	frameshift_variant	Average:89.853; most accessible tissue: Zhenshan97 panicle, score: 92.66	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0627151716	A	C	0.01	0.01	0.0	-0.02	-0.01	-0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0627151716	NA	6.22E-07	mr1088	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627151716	NA	5.96E-06	mr1215	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627151716	NA	2.92E-18	mr1218	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627151716	NA	3.68E-22	mr1422	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627151716	NA	4.61E-19	mr1583	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627151716	NA	4.35E-15	mr1807	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627151716	NA	1.82E-07	mr1850	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627151716	NA	3.50E-25	mr1877	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627151716	NA	2.17E-09	mr1929	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627151716	NA	2.96E-06	mr1200_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627151716	NA	1.74E-07	mr1212_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627151716	NA	7.99E-21	mr1218_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627151716	NA	1.46E-15	mr1807_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627151716	NA	8.59E-15	mr1850_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251