\
| Variant ID: vg0626891249 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr06 | Position: 26891249 |
| Reference Allele: T | Alternative Allele: C,TAA |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 115. )
ATGATGGTGCAGTCCCTCTAACCCCCGATGAAAACTAAGTCACTAATGTTAAGGGGGCGGCTAGCCAATATCATTGGCGCCGAGGACCAATTTGTTTTTT[T/C,TAA]
TAAAAAAATAACCTATTTGTAGCAGAAAAGAGTCCATTTGTAATTAAAAAAGGGAGTAGCTATATTTATGGCGCCATATTTTTCACCAAAAAATAGTCAG
CTGACTATTTTTTGGTGAAAAATATGGCGCCATAAATATAGCTACTCCCTTTTTTAATTACAAATGGACTCTTTTCTGCTACAAATAGGTTATTTTTTTA[A/G,TTA]
AAAAAACAAATTGGTCCTCGGCGCCAATGATATTGGCTAGCCGCCCCCTTAACATTAGTGACTTAGTTTTCATCGGGGGTTAGAGGGACTGCACCATCAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.20% | 8.30% | 0.47% | 0.00% | TAA: 0.04% |
| All Indica | 2759 | 98.10% | 1.80% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 77.30% | 21.60% | 1.12% | 0.00% | NA |
| Aus | 269 | 97.00% | 1.50% | 0.74% | 0.00% | TAA: 0.74% |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 95.90% | 3.70% | 0.43% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 95.90% | 3.90% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 95.20% | 3.30% | 1.56% | 0.00% | NA |
| Tropical Japonica | 504 | 43.70% | 55.60% | 0.79% | 0.00% | NA |
| Japonica Intermediate | 241 | 90.90% | 8.70% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 85.60% | 14.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0626891249 | T -> C | LOC_Os06g44530.1 | intron_variant ; MODIFIER | silent_mutation | Average:62.826; most accessible tissue: Minghui63 flower, score: 83.608 | N | N | N | N |
| vg0626891249 | T -> TAA | LOC_Os06g44530.1 | intron_variant ; MODIFIER | silent_mutation | Average:62.826; most accessible tissue: Minghui63 flower, score: 83.608 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0626891249 | 5.58E-06 | NA | mr1107 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626891249 | NA | 1.04E-06 | mr1039_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626891249 | 6.85E-09 | NA | mr1082_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626891249 | NA | 8.11E-06 | mr1082_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626891249 | 1.74E-07 | NA | mr1083_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626891249 | 8.10E-07 | NA | mr1104_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626891249 | 5.74E-07 | NA | mr1107_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626891249 | 3.41E-06 | NA | mr1145_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626891249 | 8.12E-06 | NA | mr1226_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626891249 | 3.21E-06 | NA | mr1264_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626891249 | NA | 1.39E-10 | mr1408_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626891249 | NA | 3.64E-14 | mr1410_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626891249 | NA | 1.79E-06 | mr1632_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626891249 | NA | 7.21E-10 | mr1696_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626891249 | NA | 2.27E-06 | mr1860_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |