\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0626826472:

Variant ID: vg0626826472 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 26826472
Reference Allele: AAlternative Allele: G,T
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.74, A: 0.25, T: 0.01, others allele: 0.00, population size: 163. )

Flanking Sequence (100 bp) in Reference Genome:


CACACAGACCAATGATAAATAATTACTCCCTCCAGTTCTATATTAATTGACGTTTTAGACAGTATTGCAAATACCAATAACTTATTAATTAGATCCATAT[A/G,T]
TCCTGTTATACCCTTATTAAATATACTCCAACTATCTCATCTGGTTAGCGCCACCATTCCCAAAGTGTGAGGTTCTGTGTTCGAGAACTAATACTGTAAG

Reverse complement sequence

CTTACAGTATTAGTTCTCGAACACAGAACCTCACACTTTGGGAATGGTGGCGCTAACCAGATGAGATAGTTGGAGTATATTTAATAAGGGTATAACAGGA[T/C,A]
ATATGGATCTAATTAATAAGTTATTGGTATTTGCAATACTGTCTAAAACGTCAATTAATATAGAACTGGAGGGAGTAATTATTTATCATTGGTCTGTGTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.70% 11.20% 0.06% 0.00% T: 0.04%
All Indica  2759 91.20% 8.70% 0.07% 0.00% NA
All Japonica  1512 94.20% 5.80% 0.00% 0.00% NA
Aus  269 34.20% 65.40% 0.37% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 97.20% 2.60% 0.22% 0.00% NA
Indica III  913 81.20% 18.70% 0.11% 0.00% NA
Indica Intermediate  786 92.90% 7.10% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 83.90% 16.10% 0.00% 0.00% NA
Japonica Intermediate  241 97.50% 2.50% 0.00% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 74.40% 23.30% 0.00% 0.00% T: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0626826472 A -> G LOC_Os06g44420.1 upstream_gene_variant ; 3055.0bp to feature; MODIFIER silent_mutation Average:49.238; most accessible tissue: Minghui63 root, score: 74.461 N N N N
vg0626826472 A -> G LOC_Os06g44410-LOC_Os06g44420 intergenic_region ; MODIFIER silent_mutation Average:49.238; most accessible tissue: Minghui63 root, score: 74.461 N N N N
vg0626826472 A -> T LOC_Os06g44420.1 upstream_gene_variant ; 3055.0bp to feature; MODIFIER silent_mutation Average:49.238; most accessible tissue: Minghui63 root, score: 74.461 N N N N
vg0626826472 A -> T LOC_Os06g44410-LOC_Os06g44420 intergenic_region ; MODIFIER silent_mutation Average:49.238; most accessible tissue: Minghui63 root, score: 74.461 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0626826472 NA 6.07E-07 mr1262 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626826472 NA 6.03E-07 mr1049_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626826472 NA 2.50E-06 mr1291_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626826472 NA 4.39E-07 mr1344_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626826472 NA 8.83E-06 mr1597_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626826472 NA 7.17E-06 mr1704_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626826472 NA 5.10E-10 mr1808_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626826472 NA 4.69E-06 mr1892_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626826472 4.70E-06 4.70E-06 mr1981_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251