Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0626772403:

Variant ID: vg0626772403 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 26772403
Reference Allele: GAlternative Allele: C
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.86, C: 0.10, T: 0.04, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


AGATGGATCACAAGTTAATATATGGGAAGATAGTTGGATACCTTCAAGCAGTAATGGGAAGATTTTAACACCTCGAGGAAGGAACATTATCACAAAAGTT[G/C]
AAGAACTGATCAATCCAGTAAGTGGTGGATGGGATGAAGACCTGATAAATACTTTGTTCTGGCCTATTGATGCTAACCGAACAAATCCCTATTTCAGCTA

Reverse complement sequence

TAGCTGAAATAGGGATTTGTTCGGTTAGCATCAATAGGCCAGAACAAAGTATTTATCAGGTCTTCATCCCATCCACCACTTACTGGATTGATCAGTTCTT[C/G]
AACTTTTGTGATAATGTTCCTTCCTCGAGGTGTTAAAATCTTCCCATTACTGCTTGAAGGTATCCAACTATCTTCCCATATATTAACTTGTGATCCATCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.20% 46.80% 0.02% 0.00% NA
All Indica  2759 86.50% 13.50% 0.04% 0.00% NA
All Japonica  1512 0.90% 99.10% 0.00% 0.00% NA
Aus  269 30.90% 69.10% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 91.20% 8.80% 0.00% 0.00% NA
Indica III  913 78.20% 21.80% 0.00% 0.00% NA
Indica Intermediate  786 83.30% 16.50% 0.13% 0.00% NA
Temperate Japonica  767 0.90% 99.10% 0.00% 0.00% NA
Tropical Japonica  504 1.00% 99.00% 0.00% 0.00% NA
Japonica Intermediate  241 0.40% 99.60% 0.00% 0.00% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 30.00% 70.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0626772403 G -> C LOC_Os06g44350.1 upstream_gene_variant ; 3102.0bp to feature; MODIFIER silent_mutation Average:48.037; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg0626772403 G -> C LOC_Os06g44330.1 downstream_gene_variant ; 4508.0bp to feature; MODIFIER silent_mutation Average:48.037; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg0626772403 G -> C LOC_Os06g44340.1 intron_variant ; MODIFIER silent_mutation Average:48.037; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0626772403 NA 4.57E-09 mr1033 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626772403 NA 3.50E-41 mr1064 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626772403 NA 6.06E-26 mr1076 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626772403 NA 5.68E-07 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626772403 NA 6.99E-30 mr1085 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626772403 NA 1.22E-56 mr1103 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626772403 NA 2.41E-39 mr1124 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626772403 NA 9.73E-07 mr1176 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626772403 NA 3.41E-30 mr1204 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626772403 NA 9.83E-29 mr1226 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626772403 NA 1.74E-60 mr1246 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626772403 NA 9.49E-24 mr1264 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626772403 NA 2.53E-25 mr1411 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626772403 NA 7.89E-29 mr1436 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626772403 NA 9.13E-41 mr1437 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626772403 NA 4.70E-43 mr1534 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626772403 NA 1.32E-13 mr1592 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626772403 NA 1.98E-30 mr1737 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626772403 NA 3.53E-08 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626772403 NA 2.83E-59 mr1064_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626772403 1.28E-06 8.86E-06 mr1438_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626772403 NA 4.85E-15 mr1686_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251