Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0626772403:

Variant ID: vg0626772403 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 26772403
Reference Allele: G	Alternative Allele: C
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.86, C: 0.10, T: 0.04, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:

AGATGGATCACAAGTTAATATATGGGAAGATAGTTGGATACCTTCAAGCAGTAATGGGAAGATTTTAACACCTCGAGGAAGGAACATTATCACAAAAGTT[G/C]
AAGAACTGATCAATCCAGTAAGTGGTGGATGGGATGAAGACCTGATAAATACTTTGTTCTGGCCTATTGATGCTAACCGAACAAATCCCTATTTCAGCTA

Reverse complement sequence

TAGCTGAAATAGGGATTTGTTCGGTTAGCATCAATAGGCCAGAACAAAGTATTTATCAGGTCTTCATCCCATCCACCACTTACTGGATTGATCAGTTCTT[C/G]
AACTTTTGTGATAATGTTCCTTCCTCGAGGTGTTAAAATCTTCCCATTACTGCTTGAAGGTATCCAACTATCTTCCCATATATTAACTTGTGATCCATCT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.20%	46.80%	0.02%	0.00%	NA
All Indica	2759	86.50%	13.50%	0.04%	0.00%	NA
All Japonica	1512	0.90%	99.10%	0.00%	0.00%	NA
Aus	269	30.90%	69.10%	0.00%	0.00%	NA
Indica I	595	99.70%	0.30%	0.00%	0.00%	NA
Indica II	465	91.20%	8.80%	0.00%	0.00%	NA
Indica III	913	78.20%	21.80%	0.00%	0.00%	NA
Indica Intermediate	786	83.30%	16.50%	0.13%	0.00%	NA
Temperate Japonica	767	0.90%	99.10%	0.00%	0.00%	NA
Tropical Japonica	504	1.00%	99.00%	0.00%	0.00%	NA
Japonica Intermediate	241	0.40%	99.60%	0.00%	0.00%	NA
VI/Aromatic	96	4.20%	95.80%	0.00%	0.00%	NA
Intermediate	90	30.00%	70.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0626772403	G -> C	LOC_Os06g44350.1	upstream_gene_variant ; 3102.0bp to feature; MODIFIER	silent_mutation	Average:48.037; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg0626772403	G -> C	LOC_Os06g44330.1	downstream_gene_variant ; 4508.0bp to feature; MODIFIER	silent_mutation	Average:48.037; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg0626772403	G -> C	LOC_Os06g44340.1	intron_variant ; MODIFIER	silent_mutation	Average:48.037; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0626772403	NA	4.57E-09	mr1033	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626772403	NA	3.50E-41	mr1064	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626772403	NA	6.06E-26	mr1076	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626772403	NA	5.68E-07	mr1082	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626772403	NA	6.99E-30	mr1085	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626772403	NA	1.22E-56	mr1103	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626772403	NA	2.41E-39	mr1124	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626772403	NA	9.73E-07	mr1176	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626772403	NA	3.41E-30	mr1204	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626772403	NA	9.83E-29	mr1226	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626772403	NA	1.74E-60	mr1246	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626772403	NA	9.49E-24	mr1264	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626772403	NA	2.53E-25	mr1411	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626772403	NA	7.89E-29	mr1436	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626772403	NA	9.13E-41	mr1437	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626772403	NA	4.70E-43	mr1534	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626772403	NA	1.32E-13	mr1592	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626772403	NA	1.98E-30	mr1737	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626772403	NA	3.53E-08	mr1770	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626772403	NA	2.83E-59	mr1064_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626772403	1.28E-06	8.86E-06	mr1438_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626772403	NA	4.85E-15	mr1686_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251