\
| Variant ID: vg0626712547 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 26712547 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.70, A: 0.29, others allele: 0.00, population size: 195. )
TTTTCTACATTTATATTGATGTTAATGAATCTAGATAAATATATATATGTCTAGATTCATTAACTTCAATATGAATGTGGGAAATGCTAGAATGACTTAC[A/G]
TTGTTAAATGGAGGGAGTAGTAGAGAACCAGAGAATATGTTACATCTTGGGTTATGAACATATGTGTGGTTTCGTCTTTCGTGTTAGTTGTGTGATTTCA
TGAAATCACACAACTAACACGAAAGACGAAACCACACATATGTTCATAACCCAAGATGTAACATATTCTCTGGTTCTCTACTACTCCCTCCATTTAACAA[T/C]
GTAAGTCATTCTAGCATTTCCCACATTCATATTGAAGTTAATGAATCTAGACATATATATATTTATCTAGATTCATTAACATCAATATAAATGTAGAAAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.60% | 39.30% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 92.60% | 7.40% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 4.10% | 95.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 77.30% | 22.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 94.00% | 6.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 89.80% | 10.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 89.70% | 10.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 1.80% | 98.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 8.70% | 91.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.70% | 98.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 4.20% | 95.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 42.20% | 56.70% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0626712547 | A -> G | LOC_Os06g44280.1 | upstream_gene_variant ; 2319.0bp to feature; MODIFIER | silent_mutation | Average:62.461; most accessible tissue: Callus, score: 80.217 | N | N | N | N |
| vg0626712547 | A -> G | LOC_Os06g44270.1 | downstream_gene_variant ; 2658.0bp to feature; MODIFIER | silent_mutation | Average:62.461; most accessible tissue: Callus, score: 80.217 | N | N | N | N |
| vg0626712547 | A -> G | LOC_Os06g44275.1 | intron_variant ; MODIFIER | silent_mutation | Average:62.461; most accessible tissue: Callus, score: 80.217 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0626712547 | 6.03E-07 | 9.03E-43 | mr1064 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626712547 | NA | 1.61E-27 | mr1072 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626712547 | NA | 2.69E-28 | mr1075 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626712547 | NA | 3.97E-41 | mr1124 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626712547 | NA | 3.40E-16 | mr1228 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626712547 | 4.06E-06 | 2.06E-45 | mr1534 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626712547 | NA | 6.34E-08 | mr1604 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626712547 | NA | 3.23E-07 | mr1824 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626712547 | NA | 4.48E-54 | mr1861 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626712547 | NA | 2.04E-07 | mr1886 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626712547 | 1.44E-06 | 3.67E-63 | mr1064_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626712547 | NA | 2.07E-57 | mr1124_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |