\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0626712547:

Variant ID: vg0626712547 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 26712547
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.70, A: 0.29, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTCTACATTTATATTGATGTTAATGAATCTAGATAAATATATATATGTCTAGATTCATTAACTTCAATATGAATGTGGGAAATGCTAGAATGACTTAC[A/G]
TTGTTAAATGGAGGGAGTAGTAGAGAACCAGAGAATATGTTACATCTTGGGTTATGAACATATGTGTGGTTTCGTCTTTCGTGTTAGTTGTGTGATTTCA

Reverse complement sequence

TGAAATCACACAACTAACACGAAAGACGAAACCACACATATGTTCATAACCCAAGATGTAACATATTCTCTGGTTCTCTACTACTCCCTCCATTTAACAA[T/C]
GTAAGTCATTCTAGCATTTCCCACATTCATATTGAAGTTAATGAATCTAGACATATATATATTTATCTAGATTCATTAACATCAATATAAATGTAGAAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.60% 39.30% 0.02% 0.00% NA
All Indica  2759 92.60% 7.40% 0.00% 0.00% NA
All Japonica  1512 4.10% 95.90% 0.00% 0.00% NA
Aus  269 77.30% 22.70% 0.00% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 94.00% 6.00% 0.00% 0.00% NA
Indica III  913 89.80% 10.20% 0.00% 0.00% NA
Indica Intermediate  786 89.70% 10.30% 0.00% 0.00% NA
Temperate Japonica  767 1.80% 98.20% 0.00% 0.00% NA
Tropical Japonica  504 8.70% 91.30% 0.00% 0.00% NA
Japonica Intermediate  241 1.70% 98.30% 0.00% 0.00% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 42.20% 56.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0626712547 A -> G LOC_Os06g44280.1 upstream_gene_variant ; 2319.0bp to feature; MODIFIER silent_mutation Average:62.461; most accessible tissue: Callus, score: 80.217 N N N N
vg0626712547 A -> G LOC_Os06g44270.1 downstream_gene_variant ; 2658.0bp to feature; MODIFIER silent_mutation Average:62.461; most accessible tissue: Callus, score: 80.217 N N N N
vg0626712547 A -> G LOC_Os06g44275.1 intron_variant ; MODIFIER silent_mutation Average:62.461; most accessible tissue: Callus, score: 80.217 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0626712547 6.03E-07 9.03E-43 mr1064 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626712547 NA 1.61E-27 mr1072 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626712547 NA 2.69E-28 mr1075 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626712547 NA 3.97E-41 mr1124 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626712547 NA 3.40E-16 mr1228 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626712547 4.06E-06 2.06E-45 mr1534 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626712547 NA 6.34E-08 mr1604 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626712547 NA 3.23E-07 mr1824 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626712547 NA 4.48E-54 mr1861 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626712547 NA 2.04E-07 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626712547 1.44E-06 3.67E-63 mr1064_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626712547 NA 2.07E-57 mr1124_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251