\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0626678997:

Variant ID: vg0626678997 (JBrowse)Variation Type: INDEL
Chromosome: chr06Position: 26678997
Reference Allele: TTCAlternative Allele: ATC,T
Primary Allele: ATCSecondary Allele: TTC

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATGCAAACTATGCAATTAGTTTTTGTAATCTAAATTTAATGCTCTATGCATGTGTCTAAAGATTCGATGTGTTGTTTTTAGGAAAAAAATTAGAAACTA[TTC/ATC,T]
AAGGCCTAAGTGAACAAGCATCTACTCCTGTCTAGGCTCAAGGGTCAGGGTGATACCACTGCACTATACCAGCGTCCTACTCCCTCCATCTTACCGTTGC

Reverse complement sequence

GCAACGGTAAGATGGAGGGAGTAGGACGCTGGTATAGTGCAGTGGTATCACCCTGACCCTTGAGCCTAGACAGGAGTAGATGCTTGTTCACTTAGGCCTT[GAA/GAT,A]
TAGTTTCTAATTTTTTTCCTAAAAACAACACATCGAATCTTTAGACACATGCATAGAGCATTAAATTTAGATTACAAAAACTAATTGCATAGTTTGCATA

Allele Frequencies:

Populations Population SizeFrequency of ATC(primary allele) Frequency of TTC(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.60% 8.00% 3.41% 0.00% T: 0.02%
All Indica  2759 99.80% 0.10% 0.07% 0.00% NA
All Japonica  1512 65.30% 24.50% 10.19% 0.00% NA
Aus  269 99.60% 0.00% 0.00% 0.00% T: 0.37%
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.90% 0.60% 0.43% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 45.10% 39.40% 15.51% 0.00% NA
Tropical Japonica  504 90.70% 6.30% 2.98% 0.00% NA
Japonica Intermediate  241 76.80% 14.90% 8.30% 0.00% NA
VI/Aromatic  96 97.90% 0.00% 2.08% 0.00% NA
Intermediate  90 92.20% 4.40% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0626678997 TTC -> T LOC_Os06g44230.1 upstream_gene_variant ; 1142.0bp to feature; MODIFIER silent_mutation Average:71.496; most accessible tissue: Minghui63 panicle, score: 90.833 N N N N
vg0626678997 TTC -> T LOC_Os06g44220.1 downstream_gene_variant ; 1803.0bp to feature; MODIFIER silent_mutation Average:71.496; most accessible tissue: Minghui63 panicle, score: 90.833 N N N N
vg0626678997 TTC -> T LOC_Os06g44220-LOC_Os06g44230 intergenic_region ; MODIFIER silent_mutation Average:71.496; most accessible tissue: Minghui63 panicle, score: 90.833 N N N N
vg0626678997 TTC -> ATC LOC_Os06g44230.1 upstream_gene_variant ; 1143.0bp to feature; MODIFIER silent_mutation Average:71.496; most accessible tissue: Minghui63 panicle, score: 90.833 N N N N
vg0626678997 TTC -> ATC LOC_Os06g44220.1 downstream_gene_variant ; 1802.0bp to feature; MODIFIER silent_mutation Average:71.496; most accessible tissue: Minghui63 panicle, score: 90.833 N N N N
vg0626678997 TTC -> ATC LOC_Os06g44220-LOC_Os06g44230 intergenic_region ; MODIFIER silent_mutation Average:71.496; most accessible tissue: Minghui63 panicle, score: 90.833 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0626678997 TTC ATC -0.01 -0.01 -0.02 0.0 -0.02 -0.01
vg0626678997 TTC T -0.38 -0.2 -0.23 -0.07 -0.21 -0.16

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0626678997 NA 5.15E-08 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626678997 NA 3.45E-06 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626678997 4.35E-06 2.19E-09 mr1229_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626678997 NA 1.04E-07 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626678997 NA 7.93E-07 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626678997 NA 1.92E-09 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626678997 NA 2.07E-07 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251